#research-findings
#research-findings

[ follow ]

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

New research reveals how the prefrontal cortex filters conflicting stimuli during decision-making processes.

Lab mice may give first aid to unconscious mates

Mice exhibit altruistic behaviors, attempting to revive unconscious cage mates through specific actions, potentially influenced by oxytocin.

Alzheimer's timeline shows changes start as trickle, become torrent

Alzheimer's disease has two phases, with somatostatin neurons being particularly vulnerable in the early phase.

Scientists Found Microplastics in Mouse Brains

Microplastics found in mice brains may pose serious health risks by affecting blood flow and brain function.

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

New research reveals how the prefrontal cortex filters conflicting stimuli during decision-making processes.

Lab mice may give first aid to unconscious mates

Mice exhibit altruistic behaviors, attempting to revive unconscious cage mates through specific actions, potentially influenced by oxytocin.

Alzheimer's timeline shows changes start as trickle, become torrent

Alzheimer's disease has two phases, with somatostatin neurons being particularly vulnerable in the early phase.

moreneuroscience

#immunology

Scientists Describe Rare Syndrome Following Covid Vaccinations

Post-vaccination syndrome may affect some people, causing several adverse effects like fatigue and brain fog.

Research indicates potential biological changes linked to post-vaccination syndrome, warranting further investigation.

New link between shift work and obesity outlined by researchers at Trinity College Dublin

Interleukin-17A plays a key role in fat storage regulation, offering new therapeutic potential for obesity and metabolic disorders.

Scientists Describe Rare Syndrome Following Covid Vaccinations

Post-vaccination syndrome may affect some people, causing several adverse effects like fatigue and brain fog.

Research indicates potential biological changes linked to post-vaccination syndrome, warranting further investigation.

New link between shift work and obesity outlined by researchers at Trinity College Dublin

Interleukin-17A plays a key role in fat storage regulation, offering new therapeutic potential for obesity and metabolic disorders.

moreimmunology

Retirees could be depleting pension pots a decade too soon due to lottery effect - London Business News | Londonlovesbusiness.com

Retirees risk depleting pension pots early due to impulsive spending behavior influenced by sudden access to cash.

European boffins want AI model tests put to the test

AI benchmarks may not reliably measure performance due to flawed design and bias in evaluation processes.

#mental-health

Investigating the Youth Mental Health Crisis - News Center

Rising mental health concerns in youth are due to multiple factors, including insufficient inpatient care access.

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

The gut microbiome significantly affects mental health and stress response through its influence on the body's circadian rhythms.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.

Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Estrangement is a widespread issue in families, often led by emotional manipulation and volatile relationships.

Study Finds Social Groups Can Influence Your Microbiome

Social groups can influence the microbiome, with potential implications for mental health and relationships.

Investigating the Youth Mental Health Crisis - News Center

Rising mental health concerns in youth are due to multiple factors, including insufficient inpatient care access.

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

The gut microbiome significantly affects mental health and stress response through its influence on the body's circadian rhythms.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.

Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Estrangement is a widespread issue in families, often led by emotional manipulation and volatile relationships.

Study Finds Social Groups Can Influence Your Microbiome

Social groups can influence the microbiome, with potential implications for mental health and relationships.

moremental-health

#cognitive-abilities

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Generative AI tools may diminish critical thinking and cognitive abilities among knowledge workers.

Professional Soccer Players May Demonstrate Exceptional Cognitive Control

Success in soccer is influenced by cognitive abilities alongside physical skills.

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Generative AI tools may diminish critical thinking and cognitive abilities among knowledge workers.

Professional Soccer Players May Demonstrate Exceptional Cognitive Control

Success in soccer is influenced by cognitive abilities alongside physical skills.

morecognitive-abilities

#microplastics

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastic pollution is rising and may be affecting human brain health, but the health impacts remain largely unclear.

Microplastics can block blood vessels in mice brains, researchers find

Microplastics can block blood vessels in the brain, mimicking clots and impacting motor function.

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Real-time imaging has shown that microplastics can cause blockages in brain blood vessels, potentially worsening neurological health.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastic pollution is rising and may be affecting human brain health, but the health impacts remain largely unclear.

Microplastics can block blood vessels in mice brains, researchers find

Microplastics can block blood vessels in the brain, mimicking clots and impacting motor function.

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Real-time imaging has shown that microplastics can cause blockages in brain blood vessels, potentially worsening neurological health.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.

moremicroplastics

Study Finds Much Higher Injury Risk for Female Downhill Racers

Women downhill mountain bikers face a higher injury risk than men, indicating a need for improved safety and women-specific equipment.

#alzheimers-disease

Research Discovered Something Unsettling About Sleeping Pills

Sleeping pills may disrupt the glymphatic system, which is crucial for brain fluid clearance, potentially impacting long-term health.

A man was destined for early Alzheimer's these genes might explain his escape

A man with a genetic predisposition for Alzheimer's disease showed no cognitive decline into his 70s, defying expectations.

Research Discovered Something Unsettling About Sleeping Pills

Sleeping pills may disrupt the glymphatic system, which is crucial for brain fluid clearance, potentially impacting long-term health.

A man was destined for early Alzheimer's these genes might explain his escape

A man with a genetic predisposition for Alzheimer's disease showed no cognitive decline into his 70s, defying expectations.

morealzheimers-disease

A Climate Change Signal in the Tropical Pacific

Climate models may be flawed due to mispredictions regarding the equatorial cold tongue in the tropical Pacific Ocean.

Physics shows how crowds suck people into a vortex

Crowds at festivals can form swirling 'vortex' patterns, revealing organized movement rather than chaotic behavior.

#psychology

Scientists reveal exactly where different emotions impact your body

A fascinating map illustrates the body's physical response to different emotions, from joy affecting the whole body to anger being localized.

The study reveals that while some emotions are perceived similarly across time, others have radically different associations.

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Scare tactics: scientists offer insights on what makes a perfect prank

Jump scares trigger laughter through benign violations rather than pure surprise, connecting fear and humor in unexpected ways.

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Hypersensitivity may be a crucial component in understanding narcissism.

A new study explores the hypersensitivity scale to gain insights into narcissistic behavior.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.

Scientists reveal exactly where different emotions impact your body

A fascinating map illustrates the body's physical response to different emotions, from joy affecting the whole body to anger being localized.

The study reveals that while some emotions are perceived similarly across time, others have radically different associations.

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Scare tactics: scientists offer insights on what makes a perfect prank

Jump scares trigger laughter through benign violations rather than pure surprise, connecting fear and humor in unexpected ways.

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Hypersensitivity may be a crucial component in understanding narcissism.

A new study explores the hypersensitivity scale to gain insights into narcissistic behavior.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.

morepsychology

#health

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Walking more could add as much as 11 years to your life, study says. Here's how

Increasing physical activity to meet recommended levels can significantly enhance life expectancy, especially in inactive individuals.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

Ice baths: are they really a good idea?

Cold-water immersion offers limited benefits for long-term well-being and does not promote immediate stress relief.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Walking more could add as much as 11 years to your life, study says. Here's how

Increasing physical activity to meet recommended levels can significantly enhance life expectancy, especially in inactive individuals.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

Ice baths: are they really a good idea?

Cold-water immersion offers limited benefits for long-term well-being and does not promote immediate stress relief.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.

morehealth

Spotting a Child Predator: The Brightest Red Flags

Child sexual grooming is a deceptive strategy that prepares children for abuse while obscuring detection.

Scientists reveal surprising flirting tactic to bag you a date

Asking for help is a surprisingly effective flirting tactic that can signal romantic interest.

#microbiology

Scientists Recreate the Conditions That Sparked Complex Life

Researchers successfully induced endosymbiosis in the lab for the first time, shedding light on this pivotal evolutionary process.

Scientists Find Signs of Life Deep Inside the Earth

Microbial diversity in the Earth's subsurface may exceed that of surface environments, challenging previous assumptions.

Scientists Recreate the Conditions That Sparked Complex Life

Researchers successfully induced endosymbiosis in the lab for the first time, shedding light on this pivotal evolutionary process.

Scientists Find Signs of Life Deep Inside the Earth

Microbial diversity in the Earth's subsurface may exceed that of surface environments, challenging previous assumptions.

moremicrobiology

Snakeskin: It's Fashionable, and It Scares Predators Away From Bird Nests

Birds may use snakeskin in their nests to deter predators, supporting historical hypotheses about this behavior.

#public-health

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Child deaths in England rising above pre-pandemic levels, study finds

Child mortality in England is rising post-Covid after a temporary decrease during lockdowns, revealing persistent inequalities.

Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

Mysterious chemical byproduct in U.S. tap water finally identified

A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Child deaths in England rising above pre-pandemic levels, study finds

Child mortality in England is rising post-Covid after a temporary decrease during lockdowns, revealing persistent inequalities.

Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

Mysterious chemical byproduct in U.S. tap water finally identified

A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.

morepublic-health

Scientists Finally Make Heads of Giant Stingray Tails

Manta rays and their relatives possess unusually long tails that may serve a sensory purpose, acting like antennae to detect danger.

Today's AI models have a poor grasp of world history

Current AI models struggle to provide accurate historical information, scoring only 46% correct in a recent study.

Scientists are baffled after discovering bizarre 'icy balls' in space

Two unusual celestial objects found in the Milky Way may represent a new kind of star.

#dementia

Antibiotics, antivirals and vaccines could help tackle dementia, study suggests

Repurposing existing drugs like antibiotics and antivirals could speed up treatments for dementia.

This Sleep Occurrence May Indicate Your Risk Of Dementia

Frequent nightmares may indicate a higher risk of dementia and cognitive decline in individuals of varying ages.

Antibiotics, antivirals and vaccines could help tackle dementia, study suggests

Repurposing existing drugs like antibiotics and antivirals could speed up treatments for dementia.

This Sleep Occurrence May Indicate Your Risk Of Dementia

Frequent nightmares may indicate a higher risk of dementia and cognitive decline in individuals of varying ages.

moredementia

People with working-class accents more likely to be suspected of committing crimes

Accent bias in the UK criminal justice system raises serious concerns about stereotypes affecting perceptions of guilt and innocence.

Accents from cities like Liverpool and Newcastle are unfairly associated with crime, impacting all judicial processes.

The study highlights the need for awareness and reform in how accents influence judgment in the legal system.

Migrating Birds Sing to Team Up with Other Species

Songbirds migrating solo may share information across species, challenging the notion of complete individualism during migration.

People who play instruments more likely to pick up a second language

Musical talent is linked to fluency in foreign languages, suggesting that music education can enhance language learning.

Thousands Of Teenage Girls Took Part In A New Study. What They Revealed Should Terrify You.

Many young women struggle to express their thoughts due to societal pressures for acceptance.

#health-risks

Autism may be caused by toxins breathed in by millions every day

Air pollution during pregnancy may increase autism risk in genetically predisposed babies.

Here's Which Cancers Are Linked to Alcohol, and How Much Drinking Increases Your Risk

Alcohol consumption is widely recognized as a direct cause of several cancer types, and not just a risk factor.

A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected

Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.

An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.

Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.

Autism may be caused by toxins breathed in by millions every day

Air pollution during pregnancy may increase autism risk in genetically predisposed babies.

Here's Which Cancers Are Linked to Alcohol, and How Much Drinking Increases Your Risk

Alcohol consumption is widely recognized as a direct cause of several cancer types, and not just a risk factor.

A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected

Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.

An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.

Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.

morehealth-risks

#artificial-intelligence

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.

Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.

Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

moreartificial-intelligence

Are ground squirrels actually carnivorous? New California study finds they eat voles

California ground squirrels have been observed hunting and eating smaller rodents, indicating a more flexible diet than previously thought.

Travellers and Roma face 'high levels' of prejudice in Ireland, ESRI report finds

Travellers and Roma face the highest prejudice in Ireland; comfort levels vary by context, education, and socio-economic status.

#climate-change

New details about impact of massive asteroid that hit the US revealed

Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.

Hurricane wind strength is 18 mph stronger since 2019 due to climate change

Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.

Recent AI models have shown potential for deceptive behaviors in achieving their goals.

Most People in This Town Don't Believe in Climate Change

Recent findings suggest climate change is not accelerating as once feared, providing some relief amid ongoing concerns.

New details about impact of massive asteroid that hit the US revealed

Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.

Hurricane wind strength is 18 mph stronger since 2019 due to climate change

Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.

Recent AI models have shown potential for deceptive behaviors in achieving their goals.

Most People in This Town Don't Believe in Climate Change

Recent findings suggest climate change is not accelerating as once feared, providing some relief amid ongoing concerns.

moreclimate-change

My Husband Has a Strange Bedtime "Need." I Think He's Trying to Trick Me.

Sexual release can significantly impact sleep quality, emphasizing the importance of intimacy in this process.

Organ transplant patients are inheriting donors' personalities

Some organ recipients report changes in personality and preferences that align with their donors, prompting questions about memory transfer.

The initial verdict is in for Oakland's Universal Basic Mobility program: 'extremely helpful'

The Oakland universal basic mobility pilot shows that providing free transit can improve community equity and well-being.

#animal-behavior

Alcohol consumption abundant in the natural world, study finds

Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.

These Rats Learned to Drive-and They Love It

Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.

Elephants can wash with a hose and sabotage shower time, scientists say

Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.

Alcohol consumption abundant in the natural world, study finds

Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.

These Rats Learned to Drive-and They Love It

Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.

Elephants can wash with a hose and sabotage shower time, scientists say

Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.

moreanimal-behavior

Do you sleep on your side, stomach or back? What your sleeping position says about your personality - and your paycheck

Sleep positions may reflect personality traits influencing success and earning potential.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.

Exposure to air pollution increases infertility risk, US study finds

Air pollution exposure negatively impacts fertility for both men and women.

Agile Is Rigor Mortis as Software's State Religion | HackerNoon

Agile's status as a superior methodology is challenged by substantial failure rates in software projects, highlighting the need for informed decision-making.

How to Decide Which Innovation Projects to Greenlight

Committees often choose consensus over risk, leading to funding safer, incremental innovations rather than potentially groundbreaking projects.

#workplace-culture

Are nicknames appropriate in the workplace? Here's when it's okay to use them-and when it's not

Using nicknames for bosses can improve workplace morale and dynamics.

Context and the individual using the nickname affect its acceptance.

Walmart ditches DEI, because, duh, dividing people doesn't bring them closer together

Walmart and other major corporations are abandoning DEI programs as evidence suggests they may exacerbate racial tensions rather than alleviate them.

Are nicknames appropriate in the workplace? Here's when it's okay to use them-and when it's not

Using nicknames for bosses can improve workplace morale and dynamics.

Context and the individual using the nickname affect its acceptance.

Walmart ditches DEI, because, duh, dividing people doesn't bring them closer together

Walmart and other major corporations are abandoning DEI programs as evidence suggests they may exacerbate racial tensions rather than alleviate them.

moreworkplace-culture

Are 'ghost engineers' stunting productivity in software development?

About 9.5% of software engineers do minimal work, dubbed 'ghost' engineers, raising concerns about productivity amidst widespread burnout.

#consumer-protection

The gadgets that could be SPYING on you and sending your data to China

Many smart devices, including some air fryers, have troubling data privacy practices, potentially compromising user privacy. Awareness is key.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.

The gadgets that could be SPYING on you and sending your data to China

Many smart devices, including some air fryers, have troubling data privacy practices, potentially compromising user privacy. Awareness is key.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.

moreconsumer-protection

Crabs CAN feel pain, scientists say - as they call for ban on boiling

Crabs can feel pain similar to humans, leading scientists to call for a ban on boiling them alive.

Squirting Cucumbers Shoot Their Seeds Like Botanical Bombardiers

The squirting cucumber ejects seeds violently and rapidly as a unique method of dispersal, crucial for survival in arid regions.

#social-media

Homophobia rife in schools as 78% of primary age children report hearing insults

Homophobic language is prevalent in schools, affecting a significant number of children.

Social media platforms like TikTok contribute to the misuse of homophobic terms among youth.

Research Finds Conservatives Vastly More Likely to Share Inaccurate Articles Without Even Reading Them

Conservatives on Facebook are more likely to share unverified links, showing low media literacy across political lines.

Homophobia rife in schools as 78% of primary age children report hearing insults

Homophobic language is prevalent in schools, affecting a significant number of children.

Social media platforms like TikTok contribute to the misuse of homophobic terms among youth.

Research Finds Conservatives Vastly More Likely to Share Inaccurate Articles Without Even Reading Them

Conservatives on Facebook are more likely to share unverified links, showing low media literacy across political lines.

moresocial-media

Something Is Malfunctioning With Astronauts' Brains

Astronauts may experience temporary cognitive slowing in space, but there is no permanent impairment after six months on the ISS.

#leadership

Why sex discrimination at work doesn't go away until women are in charge | Torsten Bell

Gender balance in teams significantly impacts women's influence and representation, especially in male-majority groups.

Jekyll and Hyde managers: why they're worse than consistently horrible bosses

Inconsistent management behavior leads to emotional exhaustion and significantly lowers employee performance and morale.

Why sex discrimination at work doesn't go away until women are in charge | Torsten Bell

Gender balance in teams significantly impacts women's influence and representation, especially in male-majority groups.

Jekyll and Hyde managers: why they're worse than consistently horrible bosses

Inconsistent management behavior leads to emotional exhaustion and significantly lowers employee performance and morale.

moreleadership

Analysis Reveals the Perfect Line Between Attention & Profit

Consumer attention is crucial for advertising profit, with a near-perfect correlation observed between attention and ROI.

Tom Hanks reckons 35 is the worst age my highly unscientific research says otherwise | Emma Beddington

Tom Hanks claims 35 is the worst age due to physical decline, but happiness research shows that unhappiness peaks at around 47.2.

Dinosaurs unearthed in China may have ended with a collapse, not a catastrophe

The Yixian Formation's dinosaur fossils offer profound insights, with a new hypothesis suggesting burrow collapses contributed to their preservation instead of volcanic activity.

Revealed: The shocking origin of Australia's mysterious black balls

The black balls on Australian beaches are a mix of sewage, fats, and drugs, indicating significant human waste involvement.

Can you undo' political polarization? Left and right might be closer than we think, study finds

Political polarization is driven by assumptions about opponents rather than their actual views on democracy.

A new program aims to bridge political divides by correcting false assumptions about opposing views.

How Psychologically Troubling Is Erectile Dysfunction (ED)?

Erectile dysfunction (ED) is a complex issue, affecting men psychologically and socially, with ongoing debates on its prevalence and impact.

Bitcoin Mining Bans Can Backfire on Climate Conscious Governments, a New Research Finds

Bitcoin mining bans can backfire, driving miners to fossil fuel-reliant jurisdictions and increasing carbon emissions.

People born without sense of smell breathe differently, study finds

Loss of smell significantly impacts breathing patterns and is linked to various health issues.

[ Load more ]

#research-findings#research-findings

Scientists Found Microplastics in Mouse Brains

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

Lab mice may give first aid to unconscious mates

Alzheimer's timeline shows changes start as trickle, become torrent

Scientists Found Microplastics in Mouse Brains

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

Lab mice may give first aid to unconscious mates

Alzheimer's timeline shows changes start as trickle, become torrent

Scientists Describe Rare Syndrome Following Covid Vaccinations

New link between shift work and obesity outlined by researchers at Trinity College Dublin

Scientists Describe Rare Syndrome Following Covid Vaccinations

New link between shift work and obesity outlined by researchers at Trinity College Dublin

Retirees could be depleting pension pots a decade too soon due to lottery effect - London Business News | Londonlovesbusiness.com

European boffins want AI model tests put to the test

Investigating the Youth Mental Health Crisis - News Center

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

7,000 steps a day helps keep depression away

Nature and nurture: Two insightful studies shed light on what shapes ADHD

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Study Finds Social Groups Can Influence Your Microbiome

Investigating the Youth Mental Health Crisis - News Center

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

7,000 steps a day helps keep depression away

Nature and nurture: Two insightful studies shed light on what shapes ADHD

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Study Finds Social Groups Can Influence Your Microbiome

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Professional Soccer Players May Demonstrate Exceptional Cognitive Control

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Professional Soccer Players May Demonstrate Exceptional Cognitive Control

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastics can block blood vessels in mice brains, researchers find

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Scientists know our bodies are full of microplastics. What are they doing to us?

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastics can block blood vessels in mice brains, researchers find

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Scientists know our bodies are full of microplastics. What are they doing to us?

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Study Finds Much Higher Injury Risk for Female Downhill Racers

Research Discovered Something Unsettling About Sleeping Pills

A man was destined for early Alzheimer's these genes might explain his escape

Research Discovered Something Unsettling About Sleeping Pills

A man was destined for early Alzheimer's these genes might explain his escape

A Climate Change Signal in the Tropical Pacific

Physics shows how crowds suck people into a vortex

Scientists reveal exactly where different emotions impact your body

Middle children are more cooperative than their siblings, study suggests

Scare tactics: scientists offer insights on what makes a perfect prank

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Scientists reveal exactly where different emotions impact your body

Middle children are more cooperative than their siblings, study suggests

Scare tactics: scientists offer insights on what makes a perfect prank

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Walking more could add as much as 11 years to your life, study says. Here's how

Transitioning Into Deep Old Age: The Good News and the Bad

Ice baths: are they really a good idea?

The Hidden Burden of Loneliness

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Walking more could add as much as 11 years to your life, study says. Here's how

Transitioning Into Deep Old Age: The Good News and the Bad

Ice baths: are they really a good idea?

The Hidden Burden of Loneliness

Spotting a Child Predator: The Brightest Red Flags

Scientists reveal surprising flirting tactic to bag you a date

Scientists Recreate the Conditions That Sparked Complex Life

Scientists Find Signs of Life Deep Inside the Earth

Scientists Recreate the Conditions That Sparked Complex Life

Scientists Find Signs of Life Deep Inside the Earth

Snakeskin: It's Fashionable, and It Scares Predators Away From Bird Nests

Do Bedbugs Cause Disease?

Child deaths in England rising above pre-pandemic levels, study finds

Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Mysterious chemical byproduct in U.S. tap water finally identified

#research-findings
#research-findings