Scientists know our bodies are full of microplastics. What are they doing to us?
Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.
6 Questions on Microplastics Scientists Are Trying to Answer | KQED
Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.
Scientists know our bodies are full of microplastics. What are they doing to us?
Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.
6 Questions on Microplastics Scientists Are Trying to Answer | KQED
Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.
New details about impact of massive asteroid that hit the US revealed
Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.
Hurricane wind strength is 18 mph stronger since 2019 due to climate change
Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.
Almost 40% would agree to WW2-style RATIONING to fight climate change
About 40% of the public supports rationing fuel and meat to combat climate change.
Heat-Related Deaths in the US Rose 117 Percent Between 1999 and 2023
Climate change is leading to significantly increased heat-related deaths in the U.S., with a 117% rise from 1999 to 2023.
Cause of 650-foot mega-tsunami shook Earth for 9 days discovered
Climate change is leading to destabilization of glaciers, causing dangerous landslides and potential tsunamis.
New Tests Reveal AI's Capacity for Deception
AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.
Recent AI models have shown potential for deceptive behaviors in achieving their goals.
New details about impact of massive asteroid that hit the US revealed
Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.
Hurricane wind strength is 18 mph stronger since 2019 due to climate change
Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.
Almost 40% would agree to WW2-style RATIONING to fight climate change
About 40% of the public supports rationing fuel and meat to combat climate change.
Heat-Related Deaths in the US Rose 117 Percent Between 1999 and 2023
Climate change is leading to significantly increased heat-related deaths in the U.S., with a 117% rise from 1999 to 2023.
Cause of 650-foot mega-tsunami shook Earth for 9 days discovered
Climate change is leading to destabilization of glaciers, causing dangerous landslides and potential tsunamis.
New Tests Reveal AI's Capacity for Deception
AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.
Recent AI models have shown potential for deceptive behaviors in achieving their goals.
Migrating birds may not save energy in warmer climates as previously assumed, challenging long-held beliefs about the benefits of migration.
Alcohol consumption abundant in the natural world, study finds
Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.
Dogs can TALK by pressing buttons - here's how to try it with your pet
Dogs can communicate with their owners by pressing soundboard buttons programmed with words, showcasing their understanding and ability to express feelings.
These Rats Learned to Drive-and They Love It
Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.
Dogs can remember names of toys years after not seeing them, study shows
Dogs can remember toy names for two years, showcasing impressive long-term memory capabilities.
Elephants can wash with a hose and sabotage shower time, scientists say
Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.
Study Reveals Bird-Migration Mystery
Migrating birds may not save energy in warmer climates as previously assumed, challenging long-held beliefs about the benefits of migration.
Alcohol consumption abundant in the natural world, study finds
Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.
Dogs can TALK by pressing buttons - here's how to try it with your pet
Dogs can communicate with their owners by pressing soundboard buttons programmed with words, showcasing their understanding and ability to express feelings.
These Rats Learned to Drive-and They Love It
Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.
Dogs can remember names of toys years after not seeing them, study shows
Dogs can remember toy names for two years, showcasing impressive long-term memory capabilities.
Elephants can wash with a hose and sabotage shower time, scientists say
Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
Air pollution significantly affects children's brain development, indicating an urgent need for intervention.
Do Bedbugs Cause Disease?
Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.
Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds
Alcohol-related disease deaths in America doubled between 1999 and 2020, with significant increases noted across all age groups, especially among younger adults.
Study: Severe COVID raised risk of heart attack, stroke as much as having heart disease
Severe COVID increases the risk of serious cardiac events, comparable to individuals with existing heart disease, and persists for nearly three years.
Mysterious chemical byproduct in U.S. tap water finally identified
A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.
Walking more could add as much as 11 years to your life, study says. Here's how
Increasing physical activity to meet recommended levels can significantly enhance life expectancy, especially in inactive individuals.
Air Pollution Leads to Brain Changes in Kids
Air pollution significantly affects children's brain development, indicating an urgent need for intervention.
Do Bedbugs Cause Disease?
Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.
Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds
Alcohol-related disease deaths in America doubled between 1999 and 2020, with significant increases noted across all age groups, especially among younger adults.
Study: Severe COVID raised risk of heart attack, stroke as much as having heart disease
Severe COVID increases the risk of serious cardiac events, comparable to individuals with existing heart disease, and persists for nearly three years.
Mysterious chemical byproduct in U.S. tap water finally identified
A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.
Walking more could add as much as 11 years to your life, study says. Here's how
Increasing physical activity to meet recommended levels can significantly enhance life expectancy, especially in inactive individuals.
Agile Is Rigor Mortis as Software's State Religion | HackerNoon
Agile's status as a superior methodology is challenged by substantial failure rates in software projects, highlighting the need for informed decision-making.
How to Decide Which Innovation Projects to Greenlight
Committees often choose consensus over risk, leading to funding safer, incremental innovations rather than potentially groundbreaking projects.
Ranking is suggested as an effective method for project selection, highlighting the importance of diverse decision-making processes.
A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected
Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.
An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.
Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.
What, Exactly, Is Moderate Drinking'?
Moderate drinking definitions vary by country, and recent research questions earlier assumptions about its health benefits, suggesting they may be illusory.
A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected
Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.
An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.
Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.
What, Exactly, Is Moderate Drinking'?
Moderate drinking definitions vary by country, and recent research questions earlier assumptions about its health benefits, suggesting they may be illusory.
Dinosaurs unearthed in China may have ended with a collapse, not a catastrophe
The Yixian Formation's dinosaur fossils offer profound insights, with a new hypothesis suggesting burrow collapses contributed to their preservation instead of volcanic activity.
Revealed: The shocking origin of Australia's mysterious black balls
The black balls on Australian beaches are a mix of sewage, fats, and drugs, indicating significant human waste involvement.
New link between shift work and obesity outlined by researchers at Trinity College Dublin
Interleukin-17A plays a key role in fat storage regulation, offering new therapeutic potential for obesity and metabolic disorders.
Political assassination attempts are not an effective way to create change, says more than a 100 years' worth of data
Assassinations often result in chaos instead of political change according to research conducted by Benjamin Jones and Benjamin Olken.
The Surprising Reality of Political Violence in America
Support for political violence among Americans, especially Republicans, decreased after Trump's assassination attempt, contrary to expectations of increased violence.
Recent studies suggest that instances of extremist violence have actually declined, contradicting popular perceptions of escalating political tensions in the U.S.
Political assassination attempts are not an effective way to create change, says more than a 100 years' worth of data
Assassinations often result in chaos instead of political change according to research conducted by Benjamin Jones and Benjamin Olken.
The Surprising Reality of Political Violence in America
Support for political violence among Americans, especially Republicans, decreased after Trump's assassination attempt, contrary to expectations of increased violence.
Recent studies suggest that instances of extremist violence have actually declined, contradicting popular perceptions of escalating political tensions in the U.S.
Polarization in politics may stem from distorted views of opponents, leading to heightened hostility.
Misinformation Is Exhausting. Listening Helps
Media literacy can combat misinformation, but searching for quality news may inadvertently lead individuals into deeper misconceptions.
Sadiq Khan received thousands of abusive messages after being re-elected mayor of London
The study highlights excessive online abuse towards politicians, especially in the context of major elections, indicating a rising trend in political hostility.
What Do We See When We See Our Opponents?
Polarization in politics may stem from distorted views of opponents, leading to heightened hostility.
Misinformation Is Exhausting. Listening Helps
Media literacy can combat misinformation, but searching for quality news may inadvertently lead individuals into deeper misconceptions.
Sadiq Khan received thousands of abusive messages after being re-elected mayor of London
The study highlights excessive online abuse towards politicians, especially in the context of major elections, indicating a rising trend in political hostility.
"Gay face" is a real thing, according to this new study - Queerty
Gay men tend to share similar facial features due to societal grooming habits and biological differences, known as 'gay face'.
Research indicates that 'gay face' is a spectrum influenced by various factors, not a strict binary.
School textbooks are SEXIST, woke scientists say
Textbooks globally reflect gender stereotypes, undermining women's achievements and reinforcing traditional roles.
Evidence of Negative Time' Found in Quantum Physics Experiment
Researchers have demonstrated that photons can give the appearance of exiting a material before they enter it, suggesting a negative time effect in quantum phenomena.
PCOS Linked to Greater Risk of Eating Disorders
PCOS is widespread yet significantly misunderstood, leading to improper treatment options and potential harm to those affected.
Key Takeaways from Our Ablation Studies on LLMs | HackerNoon
Meta-prompt design is critical for improving optimization performance in large language models.
IQ test from John's Hopkins University challenges YOU to spot the 'T'
Ignoring distractions can enhance visual search performance in complex environments.
Earth to get a new 'mini-moon' for more than 50 days
A small asteroid named 2024 PT5 will orbit Earth from September 29 to November 25, acting as a mini-moon during this time.
A smile and a sympathetic ear go a long way in politics sadly, not far enough | Torsten Bell
To persuade effectively, sharing a compelling story is more important than just listening.
Study finds use of puberty blockers safe and reversible, countering anti-trans accusations
Puberty blockers for minors are safe and reversible, challenging concerns about transgender healthcare.
Parents' concerns about reproduction affect responses to their own kids coming out - LGBTQ Nation
Parents' attitudes toward children's non-heterosexual orientation may reflect concerns about future reproductive capabilities.
Deductive Verification with Natural Programs: Case Studies | HackerNoon
The article discusses using language models for deductive reasoning and their effectiveness in identifying logical errors.
On Facebook ads, users may dislike 'likes'
The effectiveness of social media advertisements varies with the type of ad and the endorsing friends.
Accumulation of 'likes' on CTA ads may not always increase user engagement.