#research-findings

[ follow ]

People with working-class accents more likely to be suspected of committing crimes

Accent bias in the UK criminal justice system raises serious concerns about stereotypes affecting perceptions of guilt and innocence.
Accents from cities like Liverpool and Newcastle are unfairly associated with crime, impacting all judicial processes.
The study highlights the need for awareness and reform in how accents influence judgment in the legal system.

Migrating Birds Sing to Team Up with Other Species

Songbirds migrating solo may share information across species, challenging the notion of complete individualism during migration.

People who play instruments more likely to pick up a second language

Musical talent is linked to fluency in foreign languages, suggesting that music education can enhance language learning.
from BuzzFeed
1 week ago

Thousands Of Teenage Girls Took Part In A New Study. What They Revealed Should Terrify You.

Many young women struggle to express their thoughts due to societal pressures for acceptance.
#psychology

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Scare tactics: scientists offer insights on what makes a perfect prank

Jump scares trigger laughter through benign violations rather than pure surprise, connecting fear and humor in unexpected ways.

Humans can identify smells in just 0.06 SECONDS

Our sense of smell is faster than previously believed, detecting changes within just 60 milliseconds.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Scare tactics: scientists offer insights on what makes a perfect prank

Jump scares trigger laughter through benign violations rather than pure surprise, connecting fear and humor in unexpected ways.

Humans can identify smells in just 0.06 SECONDS

Our sense of smell is faster than previously believed, detecting changes within just 60 milliseconds.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.
morepsychology
#mental-health

LGBTQ+ people may have higher risk of dementia, study suggests

LGBTQ+ individuals face higher risks of dementia and depression due to minority stress and discrimination, according to extensive research.

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

The gut microbiome significantly affects mental health and stress response through its influence on the body's circadian rhythms.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.
Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Estrangement is a widespread issue in families, often led by emotional manipulation and volatile relationships.

Study Finds Social Groups Can Influence Your Microbiome

Social groups can influence the microbiome, with potential implications for mental health and relationships.

LGBTQ+ people may have higher risk of dementia, study suggests

LGBTQ+ individuals face higher risks of dementia and depression due to minority stress and discrimination, according to extensive research.

This Probiotic Could Be A Missing Link Between Our Gut and Our Mental Health

The gut microbiome significantly affects mental health and stress response through its influence on the body's circadian rhythms.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.
Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

I never want you around your grandchild': the families torn apart when adult children decide to go no contact'

Estrangement is a widespread issue in families, often led by emotional manipulation and volatile relationships.

Study Finds Social Groups Can Influence Your Microbiome

Social groups can influence the microbiome, with potential implications for mental health and relationships.
moremental-health
#health-risks

Autism may be caused by toxins breathed in by millions every day

Air pollution during pregnancy may increase autism risk in genetically predisposed babies.

Here's Which Cancers Are Linked to Alcohol, and How Much Drinking Increases Your Risk

Alcohol consumption is widely recognized as a direct cause of several cancer types, and not just a risk factor.

A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected

Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.

An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.

Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.

What, Exactly, Is Moderate Drinking'?

Moderate drinking definitions vary by country, and recent research questions earlier assumptions about its health benefits, suggesting they may be illusory.

Autism may be caused by toxins breathed in by millions every day

Air pollution during pregnancy may increase autism risk in genetically predisposed babies.

Here's Which Cancers Are Linked to Alcohol, and How Much Drinking Increases Your Risk

Alcohol consumption is widely recognized as a direct cause of several cancer types, and not just a risk factor.

A New Study On Pregnancy And Cannabis Use Reveals Something Researchers Already Suspected

Cannabis exposure in pregnancy negatively affects children's impulse control, attention, and behavior.

An expert in the risks of alcohol drank heavily for years. His 'dry by default' rule helped him drink less, lose weight, and live a fuller life.

Moderation in alcohol consumption is increasingly seen as harmful with no safe level advocated.

6 Questions on Microplastics Scientists Are Trying to Answer | KQED

Microplastics are suspected of negatively impacting human health, warranting urgent action and substantive changes regarding plastic production.

What, Exactly, Is Moderate Drinking'?

Moderate drinking definitions vary by country, and recent research questions earlier assumptions about its health benefits, suggesting they may be illusory.
morehealth-risks
#public-health

Air Pollution Leads to Brain Changes in Kids

Air pollution significantly affects children's brain development, indicating an urgent need for intervention.

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds

Alcohol-related disease deaths in America doubled between 1999 and 2020, with significant increases noted across all age groups, especially among younger adults.

Study: Severe COVID raised risk of heart attack, stroke as much as having heart disease

Severe COVID increases the risk of serious cardiac events, comparable to individuals with existing heart disease, and persists for nearly three years.

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

Mysterious chemical byproduct in U.S. tap water finally identified

A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.

Air Pollution Leads to Brain Changes in Kids

Air pollution significantly affects children's brain development, indicating an urgent need for intervention.

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Alcohol Deaths Have More Than Doubled in Two Decades, Study Finds

Alcohol-related disease deaths in America doubled between 1999 and 2020, with significant increases noted across all age groups, especially among younger adults.

Study: Severe COVID raised risk of heart attack, stroke as much as having heart disease

Severe COVID increases the risk of serious cardiac events, comparable to individuals with existing heart disease, and persists for nearly three years.

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

Mysterious chemical byproduct in U.S. tap water finally identified

A newly identified byproduct in tap water needs urgent assessment for potential toxicity despite current regulations ensuring its safety.
morepublic-health
#health

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.
morehealth
#artificial-intelligence

AI largely beat human CEOs in an experiment that pitted computers against people - but it also got fired more quickly

AI can outperform humans in many business aspects but struggles with unexpected events.
Unexpected crises lead to faster firing of AI compared to human CEOs.
Human adaptability and innovative thinking are essential in leadership positions.

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

These AI models reason better than their open-source peers - but still can't rival humans

AI struggles with cognitive puzzles created for humans, showing limited reasoning abilities compared to human intelligence.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.
Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

Apple study exposes deep cracks in LLMs' "reasoning" capabilities

Large language models struggle with genuine mathematical reasoning, showing brittle performance on modified benchmark problems.

AI largely beat human CEOs in an experiment that pitted computers against people - but it also got fired more quickly

AI can outperform humans in many business aspects but struggles with unexpected events.
Unexpected crises lead to faster firing of AI compared to human CEOs.
Human adaptability and innovative thinking are essential in leadership positions.

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

These AI models reason better than their open-source peers - but still can't rival humans

AI struggles with cognitive puzzles created for humans, showing limited reasoning abilities compared to human intelligence.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.
Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

Apple study exposes deep cracks in LLMs' "reasoning" capabilities

Large language models struggle with genuine mathematical reasoning, showing brittle performance on modified benchmark problems.
moreartificial-intelligence

Are ground squirrels actually carnivorous? New California study finds they eat voles

California ground squirrels have been observed hunting and eating smaller rodents, indicating a more flexible diet than previously thought.
#reproductive-health

Exposure to air pollution increases infertility risk, US study finds

Air pollution exposure negatively impacts fertility for both men and women.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.

Exposure to air pollution increases infertility risk, US study finds

Air pollution exposure negatively impacts fertility for both men and women.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.
morereproductive-health

Travellers and Roma face 'high levels' of prejudice in Ireland, ESRI report finds

Travellers and Roma face the highest prejudice in Ireland; comfort levels vary by context, education, and socio-economic status.
#climate-change

New details about impact of massive asteroid that hit the US revealed

Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.

Hurricane wind strength is 18 mph stronger since 2019 due to climate change

Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.

Almost 40% would agree to WW2-style RATIONING to fight climate change

About 40% of the public supports rationing fuel and meat to combat climate change.

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.
Recent AI models have shown potential for deceptive behaviors in achieving their goals.

State bans on commercial food waste have been largely ineffective, study finds

State bans on food waste have had minimal impact, achieving only a 1.5% reduction in landfill waste instead of the anticipated goals.

Most People in This Town Don't Believe in Climate Change

Recent findings suggest climate change is not accelerating as once feared, providing some relief amid ongoing concerns.

New details about impact of massive asteroid that hit the US revealed

Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.

Hurricane wind strength is 18 mph stronger since 2019 due to climate change

Human-caused climate change has made Atlantic hurricanes significantly stronger, with an average wind speed increase of 18 mph over the past six years.

Almost 40% would agree to WW2-style RATIONING to fight climate change

About 40% of the public supports rationing fuel and meat to combat climate change.

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.
Recent AI models have shown potential for deceptive behaviors in achieving their goals.

State bans on commercial food waste have been largely ineffective, study finds

State bans on food waste have had minimal impact, achieving only a 1.5% reduction in landfill waste instead of the anticipated goals.

Most People in This Town Don't Believe in Climate Change

Recent findings suggest climate change is not accelerating as once feared, providing some relief amid ongoing concerns.
moreclimate-change

My Husband Has a Strange Bedtime "Need." I Think He's Trying to Trick Me.

Sexual release can significantly impact sleep quality, emphasizing the importance of intimacy in this process.

Organ transplant patients are inheriting donors' personalities

Some organ recipients report changes in personality and preferences that align with their donors, prompting questions about memory transfer.

The initial verdict is in for Oakland's Universal Basic Mobility program: 'extremely helpful'

The Oakland universal basic mobility pilot shows that providing free transit can improve community equity and well-being.
#animal-behavior

Study Reveals Bird-Migration Mystery

Migrating birds may not save energy in warmer climates as previously assumed, challenging long-held beliefs about the benefits of migration.

Alcohol consumption abundant in the natural world, study finds

Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.

These Rats Learned to Drive-and They Love It

Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.

Elephants can wash with a hose and sabotage shower time, scientists say

Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.

Study Reveals Bird-Migration Mystery

Migrating birds may not save energy in warmer climates as previously assumed, challenging long-held beliefs about the benefits of migration.

Alcohol consumption abundant in the natural world, study finds

Alcohol consumption is common among various animal species, challenging the notion that it's exclusively a human behavior.

These Rats Learned to Drive-and They Love It

Rats can learn to drive small vehicles to reach rewards, demonstrating their ability to adapt and learn in enriched environments.

Elephants can wash with a hose and sabotage shower time, scientists say

Elephants display advanced tool-using skills, as shown by Mary using a hose like a shower, highlighting their intelligence and social behaviors.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.
moreanimal-behavior

This Sleep Occurrence May Indicate Your Risk Of Dementia

Frequent nightmares may indicate a higher risk of dementia and cognitive decline in individuals of varying ages.

Do you sleep on your side, stomach or back? What your sleeping position says about your personality - and your paycheck

Sleep positions may reflect personality traits influencing success and earning potential.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.

Agile Is Rigor Mortis as Software's State Religion | HackerNoon

Agile's status as a superior methodology is challenged by substantial failure rates in software projects, highlighting the need for informed decision-making.

How to Decide Which Innovation Projects to Greenlight

Committees often choose consensus over risk, leading to funding safer, incremental innovations rather than potentially groundbreaking projects.
Ranking is suggested as an effective method for project selection, highlighting the importance of diverse decision-making processes.
#workplace-culture

Are nicknames appropriate in the workplace? Here's when it's okay to use them-and when it's not

Using nicknames for bosses can improve workplace morale and dynamics.
Context and the individual using the nickname affect its acceptance.

Walmart ditches DEI, because, duh, dividing people doesn't bring them closer together

Walmart and other major corporations are abandoning DEI programs as evidence suggests they may exacerbate racial tensions rather than alleviate them.

Are nicknames appropriate in the workplace? Here's when it's okay to use them-and when it's not

Using nicknames for bosses can improve workplace morale and dynamics.
Context and the individual using the nickname affect its acceptance.

Walmart ditches DEI, because, duh, dividing people doesn't bring them closer together

Walmart and other major corporations are abandoning DEI programs as evidence suggests they may exacerbate racial tensions rather than alleviate them.
moreworkplace-culture

Are 'ghost engineers' stunting productivity in software development?

About 9.5% of software engineers do minimal work, dubbed 'ghost' engineers, raising concerns about productivity amidst widespread burnout.
#consumer-protection

The gadgets that could be SPYING on you and sending your data to China

Many smart devices, including some air fryers, have troubling data privacy practices, potentially compromising user privacy. Awareness is key.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.

The gadgets that could be SPYING on you and sending your data to China

Many smart devices, including some air fryers, have troubling data privacy practices, potentially compromising user privacy. Awareness is key.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.
moreconsumer-protection
#animal-welfare

Crabs CAN feel pain, scientists say - as they call for ban on boiling

Crabs can feel pain similar to humans, leading scientists to call for a ban on boiling them alive.

What Do Americans Think About Animal Protection Policies?

Public attitudes toward animal protection are shifting significantly, emphasizing the need for policies to reflect these changing views.

Crabs CAN feel pain, scientists say - as they call for ban on boiling

Crabs can feel pain similar to humans, leading scientists to call for a ban on boiling them alive.

What Do Americans Think About Animal Protection Policies?

Public attitudes toward animal protection are shifting significantly, emphasizing the need for policies to reflect these changing views.
moreanimal-welfare

Squirting Cucumbers Shoot Their Seeds Like Botanical Bombardiers

The squirting cucumber ejects seeds violently and rapidly as a unique method of dispersal, crucial for survival in arid regions.
#social-media

Mark Zuckerberg says there's 'no causal connection' between social media and teen mental health

Zuckerberg argues that most high-quality research shows no direct link between social media and teen mental health issues.

Homophobia rife in schools as 78% of primary age children report hearing insults

Homophobic language is prevalent in schools, affecting a significant number of children.
Social media platforms like TikTok contribute to the misuse of homophobic terms among youth.

Research Finds Conservatives Vastly More Likely to Share Inaccurate Articles Without Even Reading Them

Conservatives on Facebook are more likely to share unverified links, showing low media literacy across political lines.

Mark Zuckerberg says there's 'no causal connection' between social media and teen mental health

Zuckerberg argues that most high-quality research shows no direct link between social media and teen mental health issues.

Homophobia rife in schools as 78% of primary age children report hearing insults

Homophobic language is prevalent in schools, affecting a significant number of children.
Social media platforms like TikTok contribute to the misuse of homophobic terms among youth.

Research Finds Conservatives Vastly More Likely to Share Inaccurate Articles Without Even Reading Them

Conservatives on Facebook are more likely to share unverified links, showing low media literacy across political lines.
moresocial-media

Something Is Malfunctioning With Astronauts' Brains

Astronauts may experience temporary cognitive slowing in space, but there is no permanent impairment after six months on the ISS.
#leadership

Why sex discrimination at work doesn't go away until women are in charge | Torsten Bell

Gender balance in teams significantly impacts women's influence and representation, especially in male-majority groups.

Jekyll and Hyde managers: why they're worse than consistently horrible bosses

Inconsistent management behavior leads to emotional exhaustion and significantly lowers employee performance and morale.

Why sex discrimination at work doesn't go away until women are in charge | Torsten Bell

Gender balance in teams significantly impacts women's influence and representation, especially in male-majority groups.

Jekyll and Hyde managers: why they're worse than consistently horrible bosses

Inconsistent management behavior leads to emotional exhaustion and significantly lowers employee performance and morale.
moreleadership
from Exchangewire
2 months ago

Analysis Reveals the Perfect Line Between Attention & Profit

Consumer attention is crucial for advertising profit, with a near-perfect correlation observed between attention and ROI.
#neuroscience

Fruit flies are hard to swat. Mapping their brain might tell us why

The fruit fly connectome reveals complex neural networks and interactions, illustrating the intricacies of even the smallest brains.
This advancement in mapping connects to broader efforts in neuroscience, including future work on mapping the mouse brain.

Alzheimer's timeline shows changes start as trickle, become torrent

Alzheimer's disease has two phases, with somatostatin neurons being particularly vulnerable in the early phase.

Fruit flies are hard to swat. Mapping their brain might tell us why

The fruit fly connectome reveals complex neural networks and interactions, illustrating the intricacies of even the smallest brains.
This advancement in mapping connects to broader efforts in neuroscience, including future work on mapping the mouse brain.

Alzheimer's timeline shows changes start as trickle, become torrent

Alzheimer's disease has two phases, with somatostatin neurons being particularly vulnerable in the early phase.
moreneuroscience
#aging

Study finds travel can reduce impacts of premature aging

Travel can help prevent premature aging by alleviating stress and enhancing overall health.
Positive travel experiences may improve mental and physical wellness.

Tom Hanks reckons 35 is the worst age my highly unscientific research says otherwise | Emma Beddington

Tom Hanks claims 35 is the worst age due to physical decline, but happiness research shows that unhappiness peaks at around 47.2.

Study finds travel can reduce impacts of premature aging

Travel can help prevent premature aging by alleviating stress and enhancing overall health.
Positive travel experiences may improve mental and physical wellness.

Tom Hanks reckons 35 is the worst age my highly unscientific research says otherwise | Emma Beddington

Tom Hanks claims 35 is the worst age due to physical decline, but happiness research shows that unhappiness peaks at around 47.2.
moreaging

Dinosaurs unearthed in China may have ended with a collapse, not a catastrophe

The Yixian Formation's dinosaur fossils offer profound insights, with a new hypothesis suggesting burrow collapses contributed to their preservation instead of volcanic activity.

Revealed: The shocking origin of Australia's mysterious black balls

The black balls on Australian beaches are a mix of sewage, fats, and drugs, indicating significant human waste involvement.

New link between shift work and obesity outlined by researchers at Trinity College Dublin

Interleukin-17A plays a key role in fat storage regulation, offering new therapeutic potential for obesity and metabolic disorders.
#public-perception

Can you undo' political polarization? Left and right might be closer than we think, study finds

Political polarization is driven by assumptions about opponents rather than their actual views on democracy.
A new program aims to bridge political divides by correcting false assumptions about opposing views.

Irregular migration into UK and large European countries is same as 2008, research shows

Despite hostile discourse, the number of irregular migrants in the UK and Europe has remained stable since 2008, contrary to popular belief.

Can you undo' political polarization? Left and right might be closer than we think, study finds

Political polarization is driven by assumptions about opponents rather than their actual views on democracy.
A new program aims to bridge political divides by correcting false assumptions about opposing views.

Irregular migration into UK and large European countries is same as 2008, research shows

Despite hostile discourse, the number of irregular migrants in the UK and Europe has remained stable since 2008, contrary to popular belief.
morepublic-perception

How Psychologically Troubling Is Erectile Dysfunction (ED)?

Erectile dysfunction (ED) is a complex issue, affecting men psychologically and socially, with ongoing debates on its prevalence and impact.

Bitcoin Mining Bans Can Backfire on Climate Conscious Governments, a New Research Finds

Bitcoin mining bans can backfire, driving miners to fossil fuel-reliant jurisdictions and increasing carbon emissions.

People born without sense of smell breathe differently, study finds

Loss of smell significantly impacts breathing patterns and is linked to various health issues.

Access to food is not the problem': new orca study deepens mystery behind endangerment

Southern resident killer whales face critical challenges despite access to their main food source, chinook salmon.
#political-violence

Political assassination attempts are not an effective way to create change, says more than a 100 years' worth of data

Assassinations often result in chaos instead of political change according to research conducted by Benjamin Jones and Benjamin Olken.

The Surprising Reality of Political Violence in America

Support for political violence among Americans, especially Republicans, decreased after Trump's assassination attempt, contrary to expectations of increased violence.
Recent studies suggest that instances of extremist violence have actually declined, contradicting popular perceptions of escalating political tensions in the U.S.

Political assassination attempts are not an effective way to create change, says more than a 100 years' worth of data

Assassinations often result in chaos instead of political change according to research conducted by Benjamin Jones and Benjamin Olken.

The Surprising Reality of Political Violence in America

Support for political violence among Americans, especially Republicans, decreased after Trump's assassination attempt, contrary to expectations of increased violence.
Recent studies suggest that instances of extremist violence have actually declined, contradicting popular perceptions of escalating political tensions in the U.S.
morepolitical-violence

EVs - What Are They Good For? - Streetsblog USA

U.S. electric vehicles are only slightly less harmful to the environment than gasoline cars, prompting a reexamination of subsidies.

The badminton model of planet formation

Lin's study offers a simplified method to understand dust alignment in protoplanetary disks, crucial for the early stages of planet formation.
#political-discourse

What Do We See When We See Our Opponents?

Polarization in politics may stem from distorted views of opponents, leading to heightened hostility.

Misinformation Is Exhausting. Listening Helps

Media literacy can combat misinformation, but searching for quality news may inadvertently lead individuals into deeper misconceptions.

What Do We See When We See Our Opponents?

Polarization in politics may stem from distorted views of opponents, leading to heightened hostility.

Misinformation Is Exhausting. Listening Helps

Media literacy can combat misinformation, but searching for quality news may inadvertently lead individuals into deeper misconceptions.
morepolitical-discourse

"Gay face" is a real thing, according to this new study - Queerty

Gay men tend to share similar facial features due to societal grooming habits and biological differences, known as 'gay face'.
Research indicates that 'gay face' is a spectrum influenced by various factors, not a strict binary.

School textbooks are SEXIST, woke scientists say

Textbooks globally reflect gender stereotypes, undermining women's achievements and reinforcing traditional roles.

Evidence of Negative Time' Found in Quantum Physics Experiment

Researchers have demonstrated that photons can give the appearance of exiting a material before they enter it, suggesting a negative time effect in quantum phenomena.

PCOS Linked to Greater Risk of Eating Disorders

PCOS is widespread yet significantly misunderstood, leading to improper treatment options and potential harm to those affected.

Key Takeaways from Our Ablation Studies on LLMs | HackerNoon

Meta-prompt design is critical for improving optimization performance in large language models.

IQ test from John's Hopkins University challenges YOU to spot the 'T'

Ignoring distractions can enhance visual search performance in complex environments.

Earth to get a new 'mini-moon' for more than 50 days

A small asteroid named 2024 PT5 will orbit Earth from September 29 to November 25, acting as a mini-moon during this time.

A smile and a sympathetic ear go a long way in politics sadly, not far enough | Torsten Bell

To persuade effectively, sharing a compelling story is more important than just listening.
[ Load more ]