#genetics

[ follow ]
#psychology

What Is Normal in a Marriage?

People are more attracted to partners whose natural smell is different from their own, influencing perceived attractiveness.

Double take: the twins they never knew they had

Discovering a long-lost twin can profoundly impact adoptees' sense of belonging and identity.

Mom or dad? Experts reveal which parent passes down traits

Maternal IQ is a strong predictor of a person's intelligence due to X-linked inheritance.

What Is Normal in a Marriage?

People are more attracted to partners whose natural smell is different from their own, influencing perceived attractiveness.

Double take: the twins they never knew they had

Discovering a long-lost twin can profoundly impact adoptees' sense of belonging and identity.

Mom or dad? Experts reveal which parent passes down traits

Maternal IQ is a strong predictor of a person's intelligence due to X-linked inheritance.
morepsychology
#neanderthals

Scientists pinpoint when humans had babies with Neanderthals

Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.

Neanderthals and humans interbred more recently than scientists thought

Humans and Neanderthals started interbreeding around 50,000 years ago, earlier than previously believed, impacting human genetics.

The mountains where Neanderthals forever changed human genetics

Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.

Studies pin down exactly when humans and Neanderthals swapped DNA

Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.

Neanderthal gene determines the shape of teeth, study finds

Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.

Craving carbs? Blame an ancient gene.

The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.

Scientists pinpoint when humans had babies with Neanderthals

Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.

Neanderthals and humans interbred more recently than scientists thought

Humans and Neanderthals started interbreeding around 50,000 years ago, earlier than previously believed, impacting human genetics.

The mountains where Neanderthals forever changed human genetics

Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.

Studies pin down exactly when humans and Neanderthals swapped DNA

Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.

Neanderthal gene determines the shape of teeth, study finds

Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.

Craving carbs? Blame an ancient gene.

The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.
moreneanderthals
#human-evolution

When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date

Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.

Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net

The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.

How Neanderthals and Other Early Humans Evolved to Eat Starch

The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.

Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests

Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.

When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date

Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.

Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net

The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.

How Neanderthals and Other Early Humans Evolved to Eat Starch

The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.

Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests

Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.
morehuman-evolution

Unusual scales on crocodile heads due to skin growth rate, scientists say

Crocodiles' head scales form through a mechanical process, differing from the genetic formation of other animal scales.
Head-scale patterns in crocodiles result from skin growth rates, not typical genetic control.

Tiny Matters Joins Multitude - New Partnership With American Cancer Society - Podcaster News

Tiny Matters explores the significant impact of genetics, microbes, and science on our world, hosted by scientists Sam Jones and Deboki Chakravarti.

Blaming our genes: The heritability of behavior

Both genetics and environment influence complex behaviors like mood and personality.

Why the genetic-testing revolution left some people behind - and what to do about it

The discovery of the BRCA1 gene has greatly improved cancer understanding but access to genetic testing remains limited 30 years later.
#health

The Secrets of Longevity: Scientific Approaches and Insights

Longevity is influenced by both genetics and lifestyle choices, emphasizing the importance of healthy habits in extending lifespan.

Why some people enter menopause early - and how that could affect their cancer risk

Genomic analysis identifies rare genetic variants that significantly impact menopause timing, potentially aiding infertility treatments and menopause predictions.

"Exercise May Be the Single Most Potent Medical Intervention Ever Known"

Exercise is a vital intervention for both physical and mental health, with ongoing research exploring its molecular mechanisms and effects.

The secret to slimming? Special 'skinny genes' double weight loss

The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.

New test reveals if you carry the anti-alcohol gene

Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.

The Secrets of Longevity: Scientific Approaches and Insights

Longevity is influenced by both genetics and lifestyle choices, emphasizing the importance of healthy habits in extending lifespan.

Why some people enter menopause early - and how that could affect their cancer risk

Genomic analysis identifies rare genetic variants that significantly impact menopause timing, potentially aiding infertility treatments and menopause predictions.

"Exercise May Be the Single Most Potent Medical Intervention Ever Known"

Exercise is a vital intervention for both physical and mental health, with ongoing research exploring its molecular mechanisms and effects.

The secret to slimming? Special 'skinny genes' double weight loss

The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.

New test reveals if you carry the anti-alcohol gene

Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.
morehealth

Share the Spirit: This nonprofit works to help people with Down syndrome thrive in the Bay Area

Down syndrome no longer means tragedy; supportive communities help families navigate challenges and celebrate their children's lives.
#evolution

The Earliest Known Animal Sex Chromosome is 480 Million Years Old

Octopuses possess a sex chromosome that has been conserved for over 480 million years, the oldest known in any animal.

Richard Dawkins's book of the dead is haunted by ghosts of past works

Dawkins explores how the history of life is inscribed in genes, highlighting the connection between ancient organisms and modern genetic makeups.

This Fish Evolved Legs That It Uses to Taste Stuff on the Seafloor

The sea robin's evolution reveals unique adaptations with its leg-like appendages used for locomotion and taste.

This Fish Has A Leg Up On The Competition | Defector

Sea robins develop leg-like fins that allow them to walk and taste prey, shedding light on evolutionary biology.

The fish with legs for walking and tasting

The development of sensory legs in sea robins is controlled by the tbx3a gene, impacting leg formation and function.

The Earliest Known Animal Sex Chromosome is 480 Million Years Old

Octopuses possess a sex chromosome that has been conserved for over 480 million years, the oldest known in any animal.

Richard Dawkins's book of the dead is haunted by ghosts of past works

Dawkins explores how the history of life is inscribed in genes, highlighting the connection between ancient organisms and modern genetic makeups.

This Fish Evolved Legs That It Uses to Taste Stuff on the Seafloor

The sea robin's evolution reveals unique adaptations with its leg-like appendages used for locomotion and taste.

This Fish Has A Leg Up On The Competition | Defector

Sea robins develop leg-like fins that allow them to walk and taste prey, shedding light on evolutionary biology.

The fish with legs for walking and tasting

The development of sensory legs in sea robins is controlled by the tbx3a gene, impacting leg formation and function.
moreevolution

Geneticists Finally Figured Out How Orange Cats Got Their Color

The genetics of orange coloration in cats has been unveiled, showing it differs significantly from the regulation found in other mammals.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.

New Genetic Variants Linked to Autism - News Center

Genetic variants linked to autism may enhance diagnoses and understanding, aiding families and the genetics community.
#depression

New research links depression to more painful periods

Depression is linked to genetics, shedding light on the relationship between period pain and mental health.

African scientists must not be priced out of mental-health research

African populations are significantly under-represented in mental health research, leading to misdiagnosis and stigmatization of individuals with mental illnesses.

New research links depression to more painful periods

Depression is linked to genetics, shedding light on the relationship between period pain and mental health.

African scientists must not be priced out of mental-health research

African populations are significantly under-represented in mental health research, leading to misdiagnosis and stigmatization of individuals with mental illnesses.
moredepression
#aging

What's the secret to living to 100? Centenarian stem cells could offer clues

Creation of a cell bank from centenarians provides a valuable resource for research on longevity and aging.

Why everything you think about living to 100 might be wrong

Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.

Naked mole rats vanquish genetic ghosts - and achieve long life

Naked mole rats suppress genetic sequences linked to aging, contributing to their longevity and unique evolutionary adaptations.

Can Stress Really Make Your Hair Go Grey?

Grey hair onset is mainly genetic, usually appearing from the twenties to fifties, with a rapid increase between ages 50 and 60.

What's the secret to living to 100? Centenarian stem cells could offer clues

Creation of a cell bank from centenarians provides a valuable resource for research on longevity and aging.

Why everything you think about living to 100 might be wrong

Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.

Naked mole rats vanquish genetic ghosts - and achieve long life

Naked mole rats suppress genetic sequences linked to aging, contributing to their longevity and unique evolutionary adaptations.

Can Stress Really Make Your Hair Go Grey?

Grey hair onset is mainly genetic, usually appearing from the twenties to fifties, with a rapid increase between ages 50 and 60.
moreaging

This week in science: water on Mars, the history of hazelnuts and a mysterious fish

Research reveals the significance of Indigenous hazelnut cultivation in British Columbia, highlighting the intersection of genetics and traditional ecological knowledge.

Viking Settlers: Iceland and Faroes Compared - Medievalists.net

Viking settlers of Iceland and the Faroe Islands had distinct origins, showcasing separate migration paths.
#ivf

What is genomic prediction and can embryos really be screened for IQ'?

Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.

Doctors Said These Women's Mutated Genes Wouldn't Harm Them

Genetic screening during IVF can lead to difficult choices regarding embryo selection and raises questions on medical understanding of X-linked diseases.

An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice

The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.

What is genomic prediction and can embryos really be screened for IQ'?

Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.

Doctors Said These Women's Mutated Genes Wouldn't Harm Them

Genetic screening during IVF can lead to difficult choices regarding embryo selection and raises questions on medical understanding of X-linked diseases.

An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice

The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.
moreivf

Why Is My Hairline Receding As A Woman? I Thought This Was A Guy Thing

Receding hairlines in women can result from hormonal shifts, genetics, and lifestyle factors.
#neuroscience

The most detailed brain map ever

Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.

Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour

Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.

Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's

Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.

Session 1: NIMH 75th Anniversary Event 3

This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.

The most detailed brain map ever

Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.

Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour

Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.

Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's

Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.

Session 1: NIMH 75th Anniversary Event 3

This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.
moreneuroscience

Daily briefing: Big tomatoes get sweeter thanks to CRISPR editing

Genetic modifications can significantly enhance the sweetness of tomatoes without altering their size.
Mobile phone data can improve the mapping and understanding of the ionosphere and navigation systems.

Miaou! Curly Tails Give Cats an Accent'

Curly tails in cats may complicate their social interactions by altering nonverbal communication.
#agriculture

Scientists identify tomato genes to tweak for sweeter fruit

Gene editing can enhance tomato sweetness without sacrificing size or yield.
Identified genes control sugar levels in tomatoes, improving flavor.

Seeds of Doubt: PTAB Rejects Plant Patent Challenge, Citing Genetic Uncertainty

The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.

Scientists identify tomato genes to tweak for sweeter fruit

Gene editing can enhance tomato sweetness without sacrificing size or yield.
Identified genes control sugar levels in tomatoes, improving flavor.

Seeds of Doubt: PTAB Rejects Plant Patent Challenge, Citing Genetic Uncertainty

The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.
moreagriculture

Color is in the eye, and brain, of the beholder

Color perception varies widely among individuals and cultures, influenced by biology, genetics, and environmental factors.

Liz Parrish vs. science: The lucrative business of serving the mega-rich who seek eternal youth

Liz Parrish's journey highlights a mother's struggle for alternative treatments amidst a skeptical medical community and media distortion.
#body-image

When the Shoe Fits, Wear It: Understanding Body Weight Set Point

Your natural weight is influenced by genetics and unique to each individual.
Forcing your body to an unnatural weight can cause harm.
Weight restoration is about nourishing the body during recovery.
Self-acceptance of your natural weight range promotes overall health.

There is no doubt I have appetites. I like my dinner. And my lunch': Jay Rayner on food, diet and cooking at home

Self-identity is tied to family genetics and cultural background, particularly regarding body image and acceptance.

When the Shoe Fits, Wear It: Understanding Body Weight Set Point

Your natural weight is influenced by genetics and unique to each individual.
Forcing your body to an unnatural weight can cause harm.
Weight restoration is about nourishing the body during recovery.
Self-acceptance of your natural weight range promotes overall health.

There is no doubt I have appetites. I like my dinner. And my lunch': Jay Rayner on food, diet and cooking at home

Self-identity is tied to family genetics and cultural background, particularly regarding body image and acceptance.
morebody-image

Researchers create first map of the spliceosome, an Achilles heel of cancer

Cells utilize the same DNA across types, but spliceosome machinery specifies which genes are expressed, creating diverse cell functions.

Does the Coriolis Effect Cause Your Cowlick?

A study on hair whorl orientation by geneticist Marjolaine Willems won the 2024 IgNobel prize, highlighting human genetic variation and its curiosities.

What DNA Can-and Can't-Tell Us About Intelligence

Inherited DNA influences intelligence variability among individuals.
Genetic research on intelligence poses risks of misuse for discrimination.
Increasing genetic literacy can optimize the benefits of genetics.
#technology

This $400 genetic test could save your life

The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.

Inside the UK lab where you can clone your PETS - for a hefty price

Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.

This $400 genetic test could save your life

The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.

Inside the UK lab where you can clone your PETS - for a hefty price

Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.
moretechnology
#biotechnology

A futurist explains 3 essential things needed to prepare for the imminent AI and biotech revolutions

Human-engineered intelligence and life indicate a radical transformation in society, with profound implications for the future.

Electrostatic Pollen - Solar-powered genomic beacon

Electrostatic Pollen is an artificial system that broadcasts plant genetic material using solar energy, creating a digital legacy for peach trees.

A futurist explains 3 essential things needed to prepare for the imminent AI and biotech revolutions

Human-engineered intelligence and life indicate a radical transformation in society, with profound implications for the future.

Electrostatic Pollen - Solar-powered genomic beacon

Electrostatic Pollen is an artificial system that broadcasts plant genetic material using solar energy, creating a digital legacy for peach trees.
morebiotechnology

Scientists discover dogs are entering a new phase of evolution

Dogs are experiencing a third wave of domestication influenced by humans' preferences for friendly, calm pets suited to a sedentary lifestyle.

The making of the gut - Harvard Gazette

Embryonic development involves both genetics and physics, critical for understanding the formation of gut structures.
Recent studies link gene-mediated geometries and physical forces in embryonic gut development.
#immigration

Trump's Remarks on Migrants Illustrate His Obsession With Genes

Trump's comments link genetics and crime, highlighting his controversial perspective on immigration and familial bloodlines.

Dem Strategist On CNN Says Trump Would Absolutely Try To Exterminate' People After Shocking Bad Genes' Rant

Aisha Mills warns that Trump's rhetoric about migrants suggests a dangerous, extremist ideology that could lead to severe consequences.

Headline Lunacy': NY Times Ridiculed for Framing on Trumps' Eugenics Remarks As Intellectual Curiosity'

The NY Times headline on Trump's comments about genetics and immigrants was criticized for downplaying the seriousness of his remarks.

Trump's Remarks on Migrants Illustrate His Obsession With Genes

Trump's comments link genetics and crime, highlighting his controversial perspective on immigration and familial bloodlines.

Dem Strategist On CNN Says Trump Would Absolutely Try To Exterminate' People After Shocking Bad Genes' Rant

Aisha Mills warns that Trump's rhetoric about migrants suggests a dangerous, extremist ideology that could lead to severe consequences.

Headline Lunacy': NY Times Ridiculed for Framing on Trumps' Eugenics Remarks As Intellectual Curiosity'

The NY Times headline on Trump's comments about genetics and immigrants was criticized for downplaying the seriousness of his remarks.
moreimmigration
#longevity

Never take health tips from world's oldest people, say scientists

Avoid taking longevity advice from centenarians; their habits may not reflect true health practices for a longer life.

Fewer calories, longer life, but with nuances: The complex relationship between fasting and longevity

Caloric restriction can extend life, but genetic factors play a crucial role in determining health outcomes.

Never take health tips from world's oldest people, say scientists

Avoid taking longevity advice from centenarians; their habits may not reflect true health practices for a longer life.

Fewer calories, longer life, but with nuances: The complex relationship between fasting and longevity

Caloric restriction can extend life, but genetic factors play a crucial role in determining health outcomes.
morelongevity

Celebrities are coughing up millions to bring back the dodo. This could end very badly | Arwa Mahdawi

A gene-editing company aims to resurrect the extinct dodo, highlighting issues of ethical revival and conservation funding.

The secret to slimming? Special 'skinny genes' double weight loss

Genetics may influence weight loss success, with specific 'skinny genes' aiding in more effective weight management.

Trump Makes Comments on Migrants Claiming They Have "Bad Genes"

The remarks made by the Republican candidate reflect extremist rhetoric and historical ignorance, posing risks to societal cohesion.
#nobel-prize

Nobel Prize in medicine honors two Mass. professors for their discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for discovering microRNA, crucial for gene regulation and potential cancer treatments.

Medicine Nobel for microRNAs

MicroRNAs play a crucial role in gene regulation and normal development across many species, underlying their evolutionary significance.

What to Know About MicroRNA, the Nobel-Prizewinning Discovery

The discovery of microRNA enables new methods for gene regulation, potentially revolutionizing disease treatment and management.

Nobel Prize goes to microRNA researchers

Victor Ambros and Gary Ruvkun won the Nobel Prize for their research on microRNA, crucial for understanding gene regulation.

Nobel Prize in medicine honors two Americans for discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for their groundbreaking work on microRNA, vital for gene regulation and organismal development.

Sweden kicks off Nobel Week with hotly anticipated Medicine Prize

The Nobel Prizes highlight significant advancements in medicine, especially in cancer and cardiovascular research amidst global crises.

Nobel Prize in medicine honors two Mass. professors for their discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for discovering microRNA, crucial for gene regulation and potential cancer treatments.

Medicine Nobel for microRNAs

MicroRNAs play a crucial role in gene regulation and normal development across many species, underlying their evolutionary significance.

What to Know About MicroRNA, the Nobel-Prizewinning Discovery

The discovery of microRNA enables new methods for gene regulation, potentially revolutionizing disease treatment and management.

Nobel Prize goes to microRNA researchers

Victor Ambros and Gary Ruvkun won the Nobel Prize for their research on microRNA, crucial for understanding gene regulation.

Nobel Prize in medicine honors two Americans for discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for their groundbreaking work on microRNA, vital for gene regulation and organismal development.

Sweden kicks off Nobel Week with hotly anticipated Medicine Prize

The Nobel Prizes highlight significant advancements in medicine, especially in cancer and cardiovascular research amidst global crises.
morenobel-prize
#parenting

Baby brain'? Fussy eater'? By dispelling such myths, science is taking the shame out of parenting | Lucy Jones

Fussy eating in children may be genetic, relieving parental guilt.
Scientific research on motherhood often contradicts common myths and unscientific beliefs.

Fussy eating in children largely down to genetics, research shows

Fussy eating in children is largely attributed to genetic factors rather than parenting influences.

You can try to get your kid to eat, but a new study says pickiness is genetic | CBC News

Picky eating in children is significantly influenced by genetics, reducing parental blame for their eating habits.

Twin study of fussy eaters reveals new clues

Fussy eating is predominantly genetic and not influenced by parenting styles.

Picky eating is a 'largely genetic trait', study finds

Genetics largely influence children's food fussiness, accounting for 60%-74% as they age, alleviating parental blame for picky eating.

Baby brain'? Fussy eater'? By dispelling such myths, science is taking the shame out of parenting | Lucy Jones

Fussy eating in children may be genetic, relieving parental guilt.
Scientific research on motherhood often contradicts common myths and unscientific beliefs.

Fussy eating in children largely down to genetics, research shows

Fussy eating in children is largely attributed to genetic factors rather than parenting influences.

You can try to get your kid to eat, but a new study says pickiness is genetic | CBC News

Picky eating in children is significantly influenced by genetics, reducing parental blame for their eating habits.

Twin study of fussy eaters reveals new clues

Fussy eating is predominantly genetic and not influenced by parenting styles.

Picky eating is a 'largely genetic trait', study finds

Genetics largely influence children's food fussiness, accounting for 60%-74% as they age, alleviating parental blame for picky eating.
moreparenting

Rapid homologue juxtaposition during meiotic chromosome pairing - Nature

Rapid juxtaposition of homologous chromosomes during meiosis occurs within 6 minutes, highlighting a highly efficient mechanism for chromosome pairing.

The 10 Most Common Misconceptions About Addictions

Addiction is a complex condition shaped by genetics, environment, and brain chemistry, not merely a result of personal choice or morality.

Nature vs. Nurture: Is Productivity Genetic? | ClickUp

Genetics can influence productivity through attention spans and motivation, offering insights into efficiency.
Understanding one's genetic predispositions can help identify areas for improvement in productivity.

It Looks Like a Vape. It's Going to Help You Lose Weight.

Metabolism is largely genetic and altering it through diet or exercise is often self-defeating.

A grey matter? Nature, nurture and the study of forming political leanings

Political beliefs may stem from a mix of genetic, environmental, and neurological factors, but determining their interplay is complex.

Are parents to blame for their kids' picky eating habits? Surprising research reveals the answer

Children's fussiness about food may be largely genetic, influencing their eating behaviors from early childhood to adolescence.

America's Favorite Seasoning Herb Is Also The Most Controversial - Tasting Table

Cilantro preferences divide the U.S. geographically, with significant differences between states on either side of the Mississippi River.

Your Kid's Picky Eating Isn't Your Fault, It's Your Genetics

Genetics largely influences picky eating in children, accounting for up to 86% of behavioral differences.

New Sickle Cell Treatments Reach Patients after Years of Effort

Sickle cell disease is complicated, affecting treatment despite a single genetic cause.
Research is multifaceted, targeting multiple levels to address the disease's complexity.

Rare white killer whale surfaces next to 'lucky and thrilled' boaters off CA. See it

Frosty, a rare white killer whale, has been spotted in California, raising interest in its genetic condition.

Scientists Crack a 50-Year Mystery to Discover a New Set of Blood Groups

The discovery of the MAL gene clarifies the significance of the AnWj antigen, enhancing blood donor matching for individuals with this rare blood group.

Daily briefing: No, Rapa Nui people didn't destroy their island

The ecosystem collapse theory for Rapa Nui has been debunked through genetic research.

Why does heart disease affect so many young South Asians?

South Asians face heightened heart disease risk despite lacking common risk factors, a phenomenon known as the South Asian paradox.

Francisco Lopera, Pioneer in Alzheimer's Research, Dies at 73

Dr. Francisco Lopera significantly advanced Alzheimer's research through his work with a large Colombian family, identifying genetic causes and focusing on care for affected patients.

Breakthrough as US researchers 'crack the autism code'

A new AI method accurately diagnoses autism based on genetic markers and brain activity, reducing diagnosis time significantly.

Solving Inflammatory Bowel Disease's Mysteries May Lead to New Therapies

Research linkage of gene to inflammatory bowel disease raises hope for tailored treatment options.
Public response to IBD research indicates a high prevalence and urgency for better therapies.
[ Load more ]