#genetics

[ follow ]
#healthcare

This $400 genetic test could save your life

The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.

Controversial genetics testing startup Nucleus Genomics raises $14M Series A | TechCrunch

Nucleus Genomics aims to revolutionize personal healthcare through genetic testing and analysis.

This $400 genetic test could save your life

The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.

Controversial genetics testing startup Nucleus Genomics raises $14M Series A | TechCrunch

Nucleus Genomics aims to revolutionize personal healthcare through genetic testing and analysis.
morehealthcare
#ancestry

When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date

Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.

Studies pin down exactly when humans and Neanderthals swapped DNA

Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.

You're probably related to Charlemagne too, scientists say

Sharon Stone discovered she is a descendant of Charlemagne, reflecting how he is a direct ancestor of nearly every European.

When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date

Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.

Studies pin down exactly when humans and Neanderthals swapped DNA

Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.

You're probably related to Charlemagne too, scientists say

Sharon Stone discovered she is a descendant of Charlemagne, reflecting how he is a direct ancestor of nearly every European.
moreancestry

My mother has two brain tumours - it's been difficult so watching her'

Brain tumour research is critically underfunded despite its complexity and increasing incidence.
Angelica Ronald is raising funds and awareness for brain tumour research in honor of her mother.
#archaeology

Genetic Study Reveals Cultural Integration in Avar Communities in the Early Middle Ages - Medievalists.net

Cultural identity among Avars in East Central Europe persisted despite significant genetic differences.

Scientists reveal the surprising height of the Biblical giant Goliath

Goliath's height may be exaggerated; archaeological evidence points towards a genetic condition rather than supernatural origins.

Genetic Study Reveals Cultural Integration in Avar Communities in the Early Middle Ages - Medievalists.net

Cultural identity among Avars in East Central Europe persisted despite significant genetic differences.

Scientists reveal the surprising height of the Biblical giant Goliath

Goliath's height may be exaggerated; archaeological evidence points towards a genetic condition rather than supernatural origins.
morearchaeology
#mental-health

Scientists find hundreds more genetic risk factors for depression

A global study reveals 300 new genetic risk factors for depression by including diverse populations, enhancing understanding and treatment options for the condition.

Break the Cycle of Family Mental Illness

Genetic factors can increase the risk of mental health issues, but do not guarantee them.
Four protective factors can help manage mental health.

An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice

The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.

Susan Kuo probes role of genetics in schizophrenia, autism - Harvard Gazette

The research by Susan Kuo aims to understand genetic contributions to schizophrenia and their developmental patterns across lifetimes.

Scientists find hundreds more genetic risk factors for depression

A global study reveals 300 new genetic risk factors for depression by including diverse populations, enhancing understanding and treatment options for the condition.

Break the Cycle of Family Mental Illness

Genetic factors can increase the risk of mental health issues, but do not guarantee them.
Four protective factors can help manage mental health.

An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice

The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.

Susan Kuo probes role of genetics in schizophrenia, autism - Harvard Gazette

The research by Susan Kuo aims to understand genetic contributions to schizophrenia and their developmental patterns across lifetimes.
moremental-health
#evolution

Our Ears Share a Common Ancestry with Fish Gills

Evolution repurposes ancient genes and structures for new functions, as seen in the development of mammalian ears from fish gills.

Survival of the luckiest? New study hints at the potential role of luck in evolution

Luck plays a significant role in individual success beyond genetics and environment.

Richard Dawkins's book of the dead is haunted by ghosts of past works

Dawkins explores how the history of life is inscribed in genes, highlighting the connection between ancient organisms and modern genetic makeups.

This Fish Has A Leg Up On The Competition | Defector

Sea robins develop leg-like fins that allow them to walk and taste prey, shedding light on evolutionary biology.

The fish with legs for walking and tasting

The development of sensory legs in sea robins is controlled by the tbx3a gene, impacting leg formation and function.

Bizarre Australian mole even more unusual than first thought, new research reveals

Marsupial moles possess unique adaptations similar to bandicoots and bilbies, revealing their evolutionary history and surprises in their genome.

Our Ears Share a Common Ancestry with Fish Gills

Evolution repurposes ancient genes and structures for new functions, as seen in the development of mammalian ears from fish gills.

Survival of the luckiest? New study hints at the potential role of luck in evolution

Luck plays a significant role in individual success beyond genetics and environment.

Richard Dawkins's book of the dead is haunted by ghosts of past works

Dawkins explores how the history of life is inscribed in genes, highlighting the connection between ancient organisms and modern genetic makeups.

This Fish Has A Leg Up On The Competition | Defector

Sea robins develop leg-like fins that allow them to walk and taste prey, shedding light on evolutionary biology.

The fish with legs for walking and tasting

The development of sensory legs in sea robins is controlled by the tbx3a gene, impacting leg formation and function.

Bizarre Australian mole even more unusual than first thought, new research reveals

Marsupial moles possess unique adaptations similar to bandicoots and bilbies, revealing their evolutionary history and surprises in their genome.
moreevolution
#healthy-lifestyle

What Matters More for Longevity: Genes or Lifestyle?

Longevity is influenced by both lifestyle choices and genetic factors, with lifestyle having significant impact up to ages 80 or 90.

The secret to slimming? Special 'skinny genes' double weight loss

Genetics may influence weight loss success, with specific 'skinny genes' aiding in more effective weight management.

People Who "Won The Genetic Lottery" Are Sharing Their Best Qualities

The author feels fortunate and attributes their physique and youthfulness to a combination of genetics and a healthy lifestyle.

What Matters More for Longevity: Genes or Lifestyle?

Longevity is influenced by both lifestyle choices and genetic factors, with lifestyle having significant impact up to ages 80 or 90.

The secret to slimming? Special 'skinny genes' double weight loss

Genetics may influence weight loss success, with specific 'skinny genes' aiding in more effective weight management.

People Who "Won The Genetic Lottery" Are Sharing Their Best Qualities

The author feels fortunate and attributes their physique and youthfulness to a combination of genetics and a healthy lifestyle.
morehealthy-lifestyle

Why are some families, like the Nolans, so affected by cancer?

Cancer risk is primarily influenced by environmental factors, making familial links complex and not easily defined.
#biotechnology

Microbes can colonize space, produce drugs and create energy researchers are simulating their inner workings to harness how

Researchers are digitally recreating microbial processes to more efficiently produce useful chemicals for various industries.

Electrostatic Pollen - Solar-powered genomic beacon

Electrostatic Pollen is an artificial system that broadcasts plant genetic material using solar energy, creating a digital legacy for peach trees.

Colossal Biosciences raises $200M at $10.2B valuation to bring back woolly mammoths | TechCrunch

Colossal Biosciences raised $200 million, reaching a $10.2 billion valuation, by showcasing rapid advancements in technology aimed at resurrecting extinct species.

Seeds of Doubt: PTAB Rejects Plant Patent Challenge, Citing Genetic Uncertainty

The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.

Microbes can colonize space, produce drugs and create energy researchers are simulating their inner workings to harness how

Researchers are digitally recreating microbial processes to more efficiently produce useful chemicals for various industries.

Electrostatic Pollen - Solar-powered genomic beacon

Electrostatic Pollen is an artificial system that broadcasts plant genetic material using solar energy, creating a digital legacy for peach trees.

Colossal Biosciences raises $200M at $10.2B valuation to bring back woolly mammoths | TechCrunch

Colossal Biosciences raised $200 million, reaching a $10.2 billion valuation, by showcasing rapid advancements in technology aimed at resurrecting extinct species.

Seeds of Doubt: PTAB Rejects Plant Patent Challenge, Citing Genetic Uncertainty

The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.
morebiotechnology

ABC's James Longman opens up about family's mental illness and trauma in new memoir

James Longman's memoir explores the genetics of mental illness while sharing his family's struggles, highlighting the possibility of healing alongside inherited trauma.

Author Correction: Common and rare variant associations with clonal haematopoiesis phenotypes

The article corrects information about the availability of genetic data for research purposes.
#ethics

What is genomic prediction and can embryos really be screened for IQ'?

Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.

Heritable polygenic editing: the next frontier in genomic medicine? - Nature

HPE raises ethical concerns, particularly regarding the potential revival of eugenics practices and the need to prioritize individual rights and societal values.

Meet Gem the cocker spaniel the face of UK pet cloning

Gem, a cloned cocker spaniel, represents a shift towards commercial pet cloning, raising ethical questions about the technology.

Inside the UK lab where you can clone your PETS - for a hefty price

Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.

What is genomic prediction and can embryos really be screened for IQ'?

Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.

Heritable polygenic editing: the next frontier in genomic medicine? - Nature

HPE raises ethical concerns, particularly regarding the potential revival of eugenics practices and the need to prioritize individual rights and societal values.

Meet Gem the cocker spaniel the face of UK pet cloning

Gem, a cloned cocker spaniel, represents a shift towards commercial pet cloning, raising ethical questions about the technology.

Inside the UK lab where you can clone your PETS - for a hefty price

Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.
moreethics
#psychology

What Is Normal in a Marriage?

People are more attracted to partners whose natural smell is different from their own, influencing perceived attractiveness.

Double take: the twins they never knew they had

Discovering a long-lost twin can profoundly impact adoptees' sense of belonging and identity.

Mom or dad? Experts reveal which parent passes down traits

Maternal IQ is a strong predictor of a person's intelligence due to X-linked inheritance.

Why the "optimism bias" rules our hopes for the future

Optimism is a psychological trait that can be influenced over time through conscious effort and understanding of its origins.

What Is Normal in a Marriage?

People are more attracted to partners whose natural smell is different from their own, influencing perceived attractiveness.

Double take: the twins they never knew they had

Discovering a long-lost twin can profoundly impact adoptees' sense of belonging and identity.

Mom or dad? Experts reveal which parent passes down traits

Maternal IQ is a strong predictor of a person's intelligence due to X-linked inheritance.

Why the "optimism bias" rules our hopes for the future

Optimism is a psychological trait that can be influenced over time through conscious effort and understanding of its origins.
morepsychology
#crispr

Correcting Genetic Spelling Errors With Next-Generation Crispr

Sam Berns' life epitomizes the urgent need for advancements in genetic treatments, particularly for disorders like progeria that code for rapid aging.

Daily briefing: Big tomatoes get sweeter thanks to CRISPR editing

Genetic modifications can significantly enhance the sweetness of tomatoes without altering their size.
Mobile phone data can improve the mapping and understanding of the ionosphere and navigation systems.

Correcting Genetic Spelling Errors With Next-Generation Crispr

Sam Berns' life epitomizes the urgent need for advancements in genetic treatments, particularly for disorders like progeria that code for rapid aging.

Daily briefing: Big tomatoes get sweeter thanks to CRISPR editing

Genetic modifications can significantly enhance the sweetness of tomatoes without altering their size.
Mobile phone data can improve the mapping and understanding of the ionosphere and navigation systems.
morecrispr

Small? Spherical? Tilted? The shape of your heart reveals your risk of cardiovascular disease

Research reveals the genetic factors linking heart shape to cardiovascular conditions in a breakthrough study of 40,000 individuals' heart structures.

Novel Technique May Accelerate Study of Gene Regulation - News Center

TurboCas offers a new approach to label chromatin-binding proteins, enhancing the study of transcriptional regulation and gene expression therapies.
#ancient-dna

Scientist challenges 'out of Africa' theory with new origin

Dr. Huan Shi proposes that human evolution actually began in East Asia, contradicting the prevalent 'out of Africa' theory.

Neanderthals and humans interbred more recently than scientists thought

Humans and Neanderthals started interbreeding around 50,000 years ago, earlier than previously believed, impacting human genetics.

Scandinavians came to Britain long before Vikings and Anglo-Saxons, finds study

Scandinavian ancestry existed in Britain long before the Anglo-Saxons, as evidenced by genetic analysis of a Roman-era individual.

Scientist challenges 'out of Africa' theory with new origin

Dr. Huan Shi proposes that human evolution actually began in East Asia, contradicting the prevalent 'out of Africa' theory.

Neanderthals and humans interbred more recently than scientists thought

Humans and Neanderthals started interbreeding around 50,000 years ago, earlier than previously believed, impacting human genetics.

Scandinavians came to Britain long before Vikings and Anglo-Saxons, finds study

Scandinavian ancestry existed in Britain long before the Anglo-Saxons, as evidenced by genetic analysis of a Roman-era individual.
moreancient-dna

66 days to build better sleep habits: By Saturday afternoon I am utterly listless'

Genetics influence whether someone is a morning person or night owl, and one should embrace their natural chronotype for better wellbeing.
#depression

New research links depression to more painful periods

Depression is linked to genetics, shedding light on the relationship between period pain and mental health.

Reduced Response to Rewards Predicts Depression in Teenagers

Biology and genetics significantly influence depression risk in adolescents, underscoring the importance of studying brain behavior in high-risk individuals.

New research links depression to more painful periods

Depression is linked to genetics, shedding light on the relationship between period pain and mental health.

Reduced Response to Rewards Predicts Depression in Teenagers

Biology and genetics significantly influence depression risk in adolescents, underscoring the importance of studying brain behavior in high-risk individuals.
moredepression
#neanderthals

Scientists pinpoint when humans had babies with Neanderthals

Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.

The mountains where Neanderthals forever changed human genetics

Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.

Neanderthal gene determines the shape of teeth, study finds

Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.

Craving carbs? Blame an ancient gene.

The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.

Scientists pinpoint when humans had babies with Neanderthals

Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.

The mountains where Neanderthals forever changed human genetics

Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.

Neanderthal gene determines the shape of teeth, study finds

Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.

Craving carbs? Blame an ancient gene.

The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.
moreneanderthals

Unusual scales on crocodile heads due to skin growth rate, scientists say

Crocodiles' head scales form through a mechanical process, differing from the genetic formation of other animal scales.
Head-scale patterns in crocodiles result from skin growth rates, not typical genetic control.

Tiny Matters Joins Multitude - New Partnership With American Cancer Society - Podcaster News

Tiny Matters explores the significant impact of genetics, microbes, and science on our world, hosted by scientists Sam Jones and Deboki Chakravarti.

Blaming our genes: The heritability of behavior

Both genetics and environment influence complex behaviors like mood and personality.
from Nature
1 month ago

Why the genetic-testing revolution left some people behind - and what to do about it

The discovery of the BRCA1 gene has greatly improved cancer understanding but access to genetic testing remains limited 30 years later.
#health

How Neanderthals and Other Early Humans Evolved to Eat Starch

The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.

The secret to slimming? Special 'skinny genes' double weight loss

The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.

Why everything you think about living to 100 might be wrong

Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.

New test reveals if you carry the anti-alcohol gene

Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.

How Neanderthals and Other Early Humans Evolved to Eat Starch

The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.

The secret to slimming? Special 'skinny genes' double weight loss

The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.

Why everything you think about living to 100 might be wrong

Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.

New test reveals if you carry the anti-alcohol gene

Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.
morehealth

Share the Spirit: This nonprofit works to help people with Down syndrome thrive in the Bay Area

Down syndrome no longer means tragedy; supportive communities help families navigate challenges and celebrate their children's lives.

Geneticists Finally Figured Out How Orange Cats Got Their Color

The genetics of orange coloration in cats has been unveiled, showing it differs significantly from the regulation found in other mammals.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
from News Center
1 month ago

New Genetic Variants Linked to Autism - News Center

Genetic variants linked to autism may enhance diagnoses and understanding, aiding families and the genetics community.
#aging

What's the secret to living to 100? Centenarian stem cells could offer clues

Creation of a cell bank from centenarians provides a valuable resource for research on longevity and aging.

Can Stress Really Make Your Hair Go Grey?

Grey hair onset is mainly genetic, usually appearing from the twenties to fifties, with a rapid increase between ages 50 and 60.

What's the secret to living to 100? Centenarian stem cells could offer clues

Creation of a cell bank from centenarians provides a valuable resource for research on longevity and aging.

Can Stress Really Make Your Hair Go Grey?

Grey hair onset is mainly genetic, usually appearing from the twenties to fifties, with a rapid increase between ages 50 and 60.
moreaging

This week in science: water on Mars, the history of hazelnuts and a mysterious fish

Research reveals the significance of Indigenous hazelnut cultivation in British Columbia, highlighting the intersection of genetics and traditional ecological knowledge.

Viking Settlers: Iceland and Faroes Compared - Medievalists.net

Viking settlers of Iceland and the Faroe Islands had distinct origins, showcasing separate migration paths.

Why Is My Hairline Receding As A Woman? I Thought This Was A Guy Thing

Receding hairlines in women can result from hormonal shifts, genetics, and lifestyle factors.
#neuroscience

The most detailed brain map ever

Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.

Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour

Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.

Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's

Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.

Session 1: NIMH 75th Anniversary Event 3

This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.

The most detailed brain map ever

Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.

Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour

Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.

Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's

Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.

Session 1: NIMH 75th Anniversary Event 3

This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.
moreneuroscience

Miaou! Curly Tails Give Cats an Accent'

Curly tails in cats may complicate their social interactions by altering nonverbal communication.

Scientists identify tomato genes to tweak for sweeter fruit

Gene editing can enhance tomato sweetness without sacrificing size or yield.
Identified genes control sugar levels in tomatoes, improving flavor.

Color is in the eye, and brain, of the beholder

Color perception varies widely among individuals and cultures, influenced by biology, genetics, and environmental factors.

Liz Parrish vs. science: The lucrative business of serving the mega-rich who seek eternal youth

Liz Parrish's journey highlights a mother's struggle for alternative treatments amidst a skeptical medical community and media distortion.

When the Shoe Fits, Wear It: Understanding Body Weight Set Point

Your natural weight is influenced by genetics and unique to each individual.
Forcing your body to an unnatural weight can cause harm.
Weight restoration is about nourishing the body during recovery.
Self-acceptance of your natural weight range promotes overall health.

Researchers create first map of the spliceosome, an Achilles heel of cancer

Cells utilize the same DNA across types, but spliceosome machinery specifies which genes are expressed, creating diverse cell functions.

Does the Coriolis Effect Cause Your Cowlick?

A study on hair whorl orientation by geneticist Marjolaine Willems won the 2024 IgNobel prize, highlighting human genetic variation and its curiosities.

What DNA Can-and Can't-Tell Us About Intelligence

Inherited DNA influences intelligence variability among individuals.
Genetic research on intelligence poses risks of misuse for discrimination.
Increasing genetic literacy can optimize the benefits of genetics.
#human-evolution

Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net

The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.

Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests

Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.

Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net

The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.

Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests

Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.
morehuman-evolution

Scientists discover dogs are entering a new phase of evolution

Dogs are experiencing a third wave of domestication influenced by humans' preferences for friendly, calm pets suited to a sedentary lifestyle.

The making of the gut - Harvard Gazette

Embryonic development involves both genetics and physics, critical for understanding the formation of gut structures.
Recent studies link gene-mediated geometries and physical forces in embryonic gut development.
#immigration

Trump's Remarks on Migrants Illustrate His Obsession With Genes

Trump's comments link genetics and crime, highlighting his controversial perspective on immigration and familial bloodlines.

Dem Strategist On CNN Says Trump Would Absolutely Try To Exterminate' People After Shocking Bad Genes' Rant

Aisha Mills warns that Trump's rhetoric about migrants suggests a dangerous, extremist ideology that could lead to severe consequences.

Headline Lunacy': NY Times Ridiculed for Framing on Trumps' Eugenics Remarks As Intellectual Curiosity'

The NY Times headline on Trump's comments about genetics and immigrants was criticized for downplaying the seriousness of his remarks.

Trump's Remarks on Migrants Illustrate His Obsession With Genes

Trump's comments link genetics and crime, highlighting his controversial perspective on immigration and familial bloodlines.

Dem Strategist On CNN Says Trump Would Absolutely Try To Exterminate' People After Shocking Bad Genes' Rant

Aisha Mills warns that Trump's rhetoric about migrants suggests a dangerous, extremist ideology that could lead to severe consequences.

Headline Lunacy': NY Times Ridiculed for Framing on Trumps' Eugenics Remarks As Intellectual Curiosity'

The NY Times headline on Trump's comments about genetics and immigrants was criticized for downplaying the seriousness of his remarks.
moreimmigration

Fewer calories, longer life, but with nuances: The complex relationship between fasting and longevity

Caloric restriction can extend life, but genetic factors play a crucial role in determining health outcomes.

Celebrities are coughing up millions to bring back the dodo. This could end very badly | Arwa Mahdawi

A gene-editing company aims to resurrect the extinct dodo, highlighting issues of ethical revival and conservation funding.

Trump Makes Comments on Migrants Claiming They Have "Bad Genes"

The remarks made by the Republican candidate reflect extremist rhetoric and historical ignorance, posing risks to societal cohesion.
#nobel-prize

Nobel Prize in medicine honors two Mass. professors for their discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for discovering microRNA, crucial for gene regulation and potential cancer treatments.

Medicine Nobel for microRNAs

MicroRNAs play a crucial role in gene regulation and normal development across many species, underlying their evolutionary significance.

What to Know About MicroRNA, the Nobel-Prizewinning Discovery

The discovery of microRNA enables new methods for gene regulation, potentially revolutionizing disease treatment and management.

Nobel Prize goes to microRNA researchers

Victor Ambros and Gary Ruvkun won the Nobel Prize for their research on microRNA, crucial for understanding gene regulation.

Nobel Prize in medicine honors two Americans for discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for their groundbreaking work on microRNA, vital for gene regulation and organismal development.

Sweden kicks off Nobel Week with hotly anticipated Medicine Prize

The Nobel Prizes highlight significant advancements in medicine, especially in cancer and cardiovascular research amidst global crises.

Nobel Prize in medicine honors two Mass. professors for their discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for discovering microRNA, crucial for gene regulation and potential cancer treatments.

Medicine Nobel for microRNAs

MicroRNAs play a crucial role in gene regulation and normal development across many species, underlying their evolutionary significance.

What to Know About MicroRNA, the Nobel-Prizewinning Discovery

The discovery of microRNA enables new methods for gene regulation, potentially revolutionizing disease treatment and management.

Nobel Prize goes to microRNA researchers

Victor Ambros and Gary Ruvkun won the Nobel Prize for their research on microRNA, crucial for understanding gene regulation.

Nobel Prize in medicine honors two Americans for discovery of microRNA

Victor Ambros and Gary Ruvkun won the Nobel Prize for their groundbreaking work on microRNA, vital for gene regulation and organismal development.

Sweden kicks off Nobel Week with hotly anticipated Medicine Prize

The Nobel Prizes highlight significant advancements in medicine, especially in cancer and cardiovascular research amidst global crises.
morenobel-prize

Baby brain'? Fussy eater'? By dispelling such myths, science is taking the shame out of parenting | Lucy Jones

Fussy eating in children may be genetic, relieving parental guilt.
Scientific research on motherhood often contradicts common myths and unscientific beliefs.

Rapid homologue juxtaposition during meiotic chromosome pairing - Nature

Rapid juxtaposition of homologous chromosomes during meiosis occurs within 6 minutes, highlighting a highly efficient mechanism for chromosome pairing.

The 10 Most Common Misconceptions About Addictions

Addiction is a complex condition shaped by genetics, environment, and brain chemistry, not merely a result of personal choice or morality.

Nature vs. Nurture: Is Productivity Genetic? | ClickUp

Genetics can influence productivity through attention spans and motivation, offering insights into efficiency.
Understanding one's genetic predispositions can help identify areas for improvement in productivity.

It Looks Like a Vape. It's Going to Help You Lose Weight.

Metabolism is largely genetic and altering it through diet or exercise is often self-defeating.
[ Load more ]