The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.
Controversial genetics testing startup Nucleus Genomics raises $14M Series A | TechCrunch
Nucleus Genomics aims to revolutionize personal healthcare through genetic testing and analysis.
This $400 genetic test could save your life
The cost of genome sequencing has dramatically decreased, making it accessible for personalized healthcare, which could enhance disease prevention strategies.
Controversial genetics testing startup Nucleus Genomics raises $14M Series A | TechCrunch
Nucleus Genomics aims to revolutionize personal healthcare through genetic testing and analysis.
When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date
Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.
Studies pin down exactly when humans and Neanderthals swapped DNA
Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.
You're probably related to Charlemagne too, scientists say
Sharon Stone discovered she is a descendant of Charlemagne, reflecting how he is a direct ancestor of nearly every European.
When Did Neandertals and Humans Interbreed? Genomics Closes In on a Date
Neandertal ancestry in non-African populations traces back to a single surge of interbreeding approximately 45,000 to 49,000 years ago.
Studies pin down exactly when humans and Neanderthals swapped DNA
Neanderthal DNA in modern humans originated from a limited number of individuals during a brief interaction period between 50,500 and 43,000 years ago.
You're probably related to Charlemagne too, scientists say
Sharon Stone discovered she is a descendant of Charlemagne, reflecting how he is a direct ancestor of nearly every European.
Scientists find hundreds more genetic risk factors for depression
A global study reveals 300 new genetic risk factors for depression by including diverse populations, enhancing understanding and treatment options for the condition.
Break the Cycle of Family Mental Illness
Genetic factors can increase the risk of mental health issues, but do not guarantee them.
Four protective factors can help manage mental health.
An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice
The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.
Susan Kuo probes role of genetics in schizophrenia, autism - Harvard Gazette
The research by Susan Kuo aims to understand genetic contributions to schizophrenia and their developmental patterns across lifetimes.
Scientists find hundreds more genetic risk factors for depression
A global study reveals 300 new genetic risk factors for depression by including diverse populations, enhancing understanding and treatment options for the condition.
Break the Cycle of Family Mental Illness
Genetic factors can increase the risk of mental health issues, but do not guarantee them.
Four protective factors can help manage mental health.
An I.V.F. Mixup, a Shocking Discovery and an Unbearable Choice
The birth of Daphna's daughter May brought unexpected joy but also sparked concerns about family resemblance for her husband Alexander.
Susan Kuo probes role of genetics in schizophrenia, autism - Harvard Gazette
The research by Susan Kuo aims to understand genetic contributions to schizophrenia and their developmental patterns across lifetimes.
The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.
Microbes can colonize space, produce drugs and create energy researchers are simulating their inner workings to harness how
Researchers are digitally recreating microbial processes to more efficiently produce useful chemicals for various industries.
The PTAB upheld a utility patent for a maize variety developed through simple crossbreeding, emphasizing the importance of genotypic considerations in patent claims.
ABC's James Longman opens up about family's mental illness and trauma in new memoir
James Longman's memoir explores the genetics of mental illness while sharing his family's struggles, highlighting the possibility of healing alongside inherited trauma.
Author Correction: Common and rare variant associations with clonal haematopoiesis phenotypes
The article corrects information about the availability of genetic data for research purposes.
What is genomic prediction and can embryos really be screened for IQ'?
Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.
Heritable polygenic editing: the next frontier in genomic medicine? - Nature
HPE raises ethical concerns, particularly regarding the potential revival of eugenics practices and the need to prioritize individual rights and societal values.
Meet Gem the cocker spaniel the face of UK pet cloning
Gem, a cloned cocker spaniel, represents a shift towards commercial pet cloning, raising ethical questions about the technology.
Inside the UK lab where you can clone your PETS - for a hefty price
Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.
What is genomic prediction and can embryos really be screened for IQ'?
Intelligence has a genetic component, but pinpointing exact contributions from specific genes is highly complex and contentious.
Heritable polygenic editing: the next frontier in genomic medicine? - Nature
HPE raises ethical concerns, particularly regarding the potential revival of eugenics practices and the need to prioritize individual rights and societal values.
Meet Gem the cocker spaniel the face of UK pet cloning
Gem, a cloned cocker spaniel, represents a shift towards commercial pet cloning, raising ethical questions about the technology.
Inside the UK lab where you can clone your PETS - for a hefty price
Cloning technology can replicate deceased pets for grieving owners, costing between £38,000 and £59,000 and taking up to a year.
New research links depression to more painful periods
Depression is linked to genetics, shedding light on the relationship between period pain and mental health.
Reduced Response to Rewards Predicts Depression in Teenagers
Biology and genetics significantly influence depression risk in adolescents, underscoring the importance of studying brain behavior in high-risk individuals.
New research links depression to more painful periods
Depression is linked to genetics, shedding light on the relationship between period pain and mental health.
Reduced Response to Rewards Predicts Depression in Teenagers
Biology and genetics significantly influence depression risk in adolescents, underscoring the importance of studying brain behavior in high-risk individuals.
Scientists pinpoint when humans had babies with Neanderthals
Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.
The mountains where Neanderthals forever changed human genetics
Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.
Neanderthal gene determines the shape of teeth, study finds
Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.
Craving carbs? Blame an ancient gene.
The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.
Scientists pinpoint when humans had babies with Neanderthals
Modern humans and Neanderthals interbred for thousands of years, influencing the genetic makeup of present-day humans, with significant interactions peaking approximately 47,000 years ago.
The mountains where Neanderthals forever changed human genetics
Neanderthals and Homo sapiens likely interbred in the Zagros Mountains, contributing to modern human DNA.
The domestication of dogs may have given Homo sapiens a competitive advantage over Neanderthals.
Neanderthal gene determines the shape of teeth, study finds
Interbreeding with Neanderthals has influenced modern tooth shape, especially among Europeans.
Craving carbs? Blame an ancient gene.
The increase of AMY1 gene copies among ancient populations correlates with the transition from hunting-gathering to agricultural societies and starch consumption.
How Neanderthals and Other Early Humans Evolved to Eat Starch
The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.
The secret to slimming? Special 'skinny genes' double weight loss
The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.
Why everything you think about living to 100 might be wrong
Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.
New test reveals if you carry the anti-alcohol gene
Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.
How Neanderthals and Other Early Humans Evolved to Eat Starch
The evolution of amylase gene variations in humans underscores adaptation to changing diets and environments throughout history.
The secret to slimming? Special 'skinny genes' double weight loss
The study identifies 14 'skinny genes' that significantly enhance weight loss when combined with regular exercise.
Why everything you think about living to 100 might be wrong
Bryan Johnson is pursuing extreme longevity through rigorous lifestyle changes, consuming 111 pills daily, drawing parallels to historical explorers seeking the unknown.
New test reveals if you carry the anti-alcohol gene
Genetic factors can cause individuals to experience adverse reactions to alcohol after consuming small amounts.
Share the Spirit: This nonprofit works to help people with Down syndrome thrive in the Bay Area
Down syndrome no longer means tragedy; supportive communities help families navigate challenges and celebrate their children's lives.
Geneticists Finally Figured Out How Orange Cats Got Their Color
The genetics of orange coloration in cats has been unveiled, showing it differs significantly from the regulation found in other mammals.
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
This week in science: water on Mars, the history of hazelnuts and a mysterious fish
Research reveals the significance of Indigenous hazelnut cultivation in British Columbia, highlighting the intersection of genetics and traditional ecological knowledge.
Viking Settlers: Iceland and Faroes Compared - Medievalists.net
Viking settlers of Iceland and the Faroe Islands had distinct origins, showcasing separate migration paths.
Why Is My Hairline Receding As A Woman? I Thought This Was A Guy Thing
Receding hairlines in women can result from hormonal shifts, genetics, and lifestyle factors.
Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.
Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour
Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.
Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's
Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.
Session 1: NIMH 75th Anniversary Event 3
This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.
The most detailed brain map ever
Fruit flies' brain mapping offers significant insights into neural networks, with broad implications for understanding human brain function.
Is it really a sin if it's hardwired in? The neurological basis for 'bad' behaviour
Human behaviors often labeled as 'sins' may stem from genetic and neurological factors rather than moral choices.
Francisco Lopera obituary: neurologist who traced genetic origin of early-onset Alzheimer's
Francisco Lopera's family-centered approach transformed Alzheimer's research, enhancing understanding of the disease's genetics and fostering trust in clinical settings.
Session 1: NIMH 75th Anniversary Event 3
This conference showcases diverse research on brain development and dynamics through expert presentations from various universities.
Curly tails in cats may complicate their social interactions by altering nonverbal communication.
Scientists identify tomato genes to tweak for sweeter fruit
Gene editing can enhance tomato sweetness without sacrificing size or yield.
Identified genes control sugar levels in tomatoes, improving flavor.
Color is in the eye, and brain, of the beholder
Color perception varies widely among individuals and cultures, influenced by biology, genetics, and environmental factors.
Liz Parrish vs. science: The lucrative business of serving the mega-rich who seek eternal youth
Liz Parrish's journey highlights a mother's struggle for alternative treatments amidst a skeptical medical community and media distortion.
When the Shoe Fits, Wear It: Understanding Body Weight Set Point
Your natural weight is influenced by genetics and unique to each individual.
Forcing your body to an unnatural weight can cause harm.
Weight restoration is about nourishing the body during recovery.
Self-acceptance of your natural weight range promotes overall health.
Researchers create first map of the spliceosome, an Achilles heel of cancer
Cells utilize the same DNA across types, but spliceosome machinery specifies which genes are expressed, creating diverse cell functions.
Does the Coriolis Effect Cause Your Cowlick?
A study on hair whorl orientation by geneticist Marjolaine Willems won the 2024 IgNobel prize, highlighting human genetic variation and its curiosities.
What DNA Can-and Can't-Tell Us About Intelligence
Inherited DNA influences intelligence variability among individuals.
Genetic research on intelligence poses risks of misuse for discrimination.
Increasing genetic literacy can optimize the benefits of genetics.
Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net
The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.
Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests
Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.
Black Death Genomes: Uncovering Medieval Genetic Clues - Medievalists.net
The EPIDEMIC project investigates how genetic traits from the Black Death era influence modern disease susceptibility.
Humans' Obsession With Carbs Came Long Before the Start of Agriculture, A New Study Suggests
Humans have evolved genetic adaptations for starch digestion over a longer timeline than previously recognized, dating back approximately 800,000 years.
Baby brain'? Fussy eater'? By dispelling such myths, science is taking the shame out of parenting | Lucy Jones
Fussy eating in children may be genetic, relieving parental guilt.
Scientific research on motherhood often contradicts common myths and unscientific beliefs.
Rapid homologue juxtaposition during meiotic chromosome pairing - Nature
Rapid juxtaposition of homologous chromosomes during meiosis occurs within 6 minutes, highlighting a highly efficient mechanism for chromosome pairing.
The 10 Most Common Misconceptions About Addictions
Addiction is a complex condition shaped by genetics, environment, and brain chemistry, not merely a result of personal choice or morality.
Nature vs. Nurture: Is Productivity Genetic? | ClickUp
Genetics can influence productivity through attention spans and motivation, offering insights into efficiency.
Understanding one's genetic predispositions can help identify areas for improvement in productivity.
It Looks Like a Vape. It's Going to Help You Lose Weight.
Metabolism is largely genetic and altering it through diet or exercise is often self-defeating.