The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
Briefly

Researchers have found that a tiny segment within the CPEB4 protein, comprising just 24 DNA letters, is crucial for brain development and autism regulation. The absence of this segment impacts 200 genes, shedding light on roughly 80% of unexplained autism cases.
Identifying that missing part of the CPEB4 protein could potentially open pathways to new therapies for autism spectrum disorders, significantly altering how we approach treatment strategies.
Read at english.elpais.com
[
|
]