The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
The Link Between a Mother's Lupus and a Child's Autism
The prevalence of Autism Spectrum Disorder (ASD) has dramatically increased over the last few decades, with a possible connection to maternal autoimmune diseases.
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
The Link Between a Mother's Lupus and a Child's Autism
The prevalence of Autism Spectrum Disorder (ASD) has dramatically increased over the last few decades, with a possible connection to maternal autoimmune diseases.
Music provides an alternative communication method for children with autism, fostering connection and confidence.
Adaptive music lessons can greatly benefit communication skills in children with autism.
Sai Kirupa Special School / Biome Environmental Solutions
The Sai Kirupa Special School's design focuses on the holistic development of special needs students, through phased construction and user-informed refinements.
Healing Beat: Using Music to Reach Autistic Kids
Music provides an alternative communication method for children with autism, fostering connection and confidence.
Adaptive music lessons can greatly benefit communication skills in children with autism.
Sai Kirupa Special School / Biome Environmental Solutions
The Sai Kirupa Special School's design focuses on the holistic development of special needs students, through phased construction and user-informed refinements.
AI can accurately predict autism risk in toddlers, enabling earlier interventions.
Early diagnosis is critical for effective intervention in autism spectrum disorder.
Desperate parents turn to magnetic therapy to help kids with autism. There's little evidence
Parents of children with autism often turn to alternative therapies like MERT, hoping to improve their child's communication and wellbeing.
Occupational Therapy For Autism: Role, Activities, And More
Occupational therapy is an effective evidence-based treatment option for children with autism spectrum disorder (ASD) to improve communication and daily activities.
New AI Tool Detects Autism Early in Toddlers
AI can accurately predict autism risk in toddlers, enabling earlier interventions.
Early diagnosis is critical for effective intervention in autism spectrum disorder.
Desperate parents turn to magnetic therapy to help kids with autism. There's little evidence
Parents of children with autism often turn to alternative therapies like MERT, hoping to improve their child's communication and wellbeing.
Occupational Therapy For Autism: Role, Activities, And More
Occupational therapy is an effective evidence-based treatment option for children with autism spectrum disorder (ASD) to improve communication and daily activities.
Researchers Gave LSD and Humans To Dogs - And Something Magical Happened
Humans and dogs exhibit inter-brain activity coupling, confirming a deep neurological connection during social interactions.
Low-Functioning Autism: Can Low-Functioning Autism Improve?
Low-functioning autism involves severe symptoms like delayed learning and lack of communication skills, leading to individuals being highly dependent on others for daily tasks.
Adam Harris accuses Mattie McGrath of 'dog whistling to conspiracy theorists' after TD's 'explosion of autism' claim
Accusation of spreading misinformation about autism spectrum disorder in the Dáil by the Taoiseach's brother, Mr. Harris.
Autism Awareness Month 2024: Supporting Strengths
Utilizing a strengths-based approach for autism can maximize the potential of children by focusing on their unique abilities and talents.
Samuel Woodward's attorney admits his client killed a gay Jewish teen but denies it was a hate crime
Samuel Woodward found acceptance in a hate group due to loneliness and a need for validation.
Defense claims the murder of Blaze Bernstein was not a hate crime but a result of a personal interaction.
Study of 4.3M pregnant women clarifies safety of antiseizure meds - Harvard Gazette
Topiramate prenatal exposure not linked to increased risk of autism spectrum disorder
Study provides insight into neurodevelopmental impacts of common antiseizure medications
Raising a child with autism in Kenya: Facing stigma, finding glimmers of hope
Parents of children with autism face challenges finding support and resources.
Limited access to diagnosis and treatment in Africa impacts children with autism.
Too young for screen time: Watching TV linked to sensory disorders in kids
TV screen time for children under 2 years old is associated with sensory differences, similar to those seen in autism spectrum disorder.
Each additional hour of screen time for children under 2 years old is linked to a 20% increased likelihood of atypical sensory processing.
Most children start using screens well before their second birthday, despite recommendations against screen time for children under 2 years old.
How a common viral infection can increase a child's autism risk
Children with congenital CMV have increased risk of autism spectrum disorder.
Bexley mum 'at wits end' after dispute leaves son out of school for over two years
Moving closer to a specialized school can significantly improve the quality of life for children with Special Educational Needs and Disabilities (SEND).