#brain-development

[ follow ]
#education

Poverty & the Brain

Poverty significantly hinders success in America, challenging the myth of the 'self-made' individual.

The Impact of Drugs on the Teenage Brain

Teenagers must understand the impacts of drug abuse on their developing brains for informed decision-making.

New Study Identifies A Predictor For Teens' Future Happiness

Teens' brain development is influenced by the kind of thinking they engage in, beyond just academic achievements.
Transcendent thinking, which involves making connections between stories and personal lives, plays a critical role in setting up teens for a happy adulthood.

Poverty & the Brain

Poverty significantly hinders success in America, challenging the myth of the 'self-made' individual.

The Impact of Drugs on the Teenage Brain

Teenagers must understand the impacts of drug abuse on their developing brains for informed decision-making.

New Study Identifies A Predictor For Teens' Future Happiness

Teens' brain development is influenced by the kind of thinking they engage in, beyond just academic achievements.
Transcendent thinking, which involves making connections between stories and personal lives, plays a critical role in setting up teens for a happy adulthood.
moreeducation

Kathryn Altman, Winner of the 2024 NIMH Three-Minute Talks Competition

Babies' neural response to novelty may predict their future communication development and vocabulary skills.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.
#neuroscience

Humanity's newest brain gains are most at risk from ageing

Human brains have evolved for enhanced decision-making but also face greater age-related decline compared to non-human primates.

Our Bigger Brains Came With a Downside: Faster Aging

The human brain's growth allowed language and coordination but increased vulnerability to aging.

A neuroscientist scanned her brain during pregnancy and postpartum. It changed in 2 major ways.

Pregnancy and postpartum significantly alter brain structure, including reduced gray matter and enhanced white matter connectivity.

Cat brains age like ours - and could help scientists to understand cognitive decline

Research on aging should consider diverse animal models like cats rather than relying solely on laboratory mice for insights into human cognitive decline.

Brain wiring is guided by activity even in very early development

Early brain development is driven by spontaneous cellular activity, not sensory experience, forming the basis for neural networks.
Understanding brain wiring mechanisms can reveal fundamental insights into human learning processes.

Ones to watch: young neuroscientists on the rise

Early intervention in youth can significantly impact long-term psychiatric health, especially in severe disorders like schizophrenia.
A multiscale modeling approach in neuroscience can predict and simulate brain development and its relation to psychiatric conditions.

Humanity's newest brain gains are most at risk from ageing

Human brains have evolved for enhanced decision-making but also face greater age-related decline compared to non-human primates.

Our Bigger Brains Came With a Downside: Faster Aging

The human brain's growth allowed language and coordination but increased vulnerability to aging.

A neuroscientist scanned her brain during pregnancy and postpartum. It changed in 2 major ways.

Pregnancy and postpartum significantly alter brain structure, including reduced gray matter and enhanced white matter connectivity.

Cat brains age like ours - and could help scientists to understand cognitive decline

Research on aging should consider diverse animal models like cats rather than relying solely on laboratory mice for insights into human cognitive decline.

Brain wiring is guided by activity even in very early development

Early brain development is driven by spontaneous cellular activity, not sensory experience, forming the basis for neural networks.
Understanding brain wiring mechanisms can reveal fundamental insights into human learning processes.

Ones to watch: young neuroscientists on the rise

Early intervention in youth can significantly impact long-term psychiatric health, especially in severe disorders like schizophrenia.
A multiscale modeling approach in neuroscience can predict and simulate brain development and its relation to psychiatric conditions.
moreneuroscience
#adolescence

COVID rapidly aged our teens' brains. Here's how we fix them

The COVID-19 pandemic has significantly worsened teen mental health issues and structurally altered the developing brain, especially in teenage girls.

Repeated bullying can affect 49 brain regions

Bullying during adolescence significantly impacts brain development and learning abilities as revealed by a large pan-European study.

COVID rapidly aged our teens' brains. Here's how we fix them

The COVID-19 pandemic has significantly worsened teen mental health issues and structurally altered the developing brain, especially in teenage girls.

Repeated bullying can affect 49 brain regions

Bullying during adolescence significantly impacts brain development and learning abilities as revealed by a large pan-European study.
moreadolescence

Why Can't I Remember My Childhood: Let's Learn About Infantile Amnesia

Infantile amnesia explains why most adults cannot recall detailed memories from childhood, especially prior to age four.
#cortical-thinning

Teen Girls' Brains Aged Rapidly During Pandemic, Study Finds

Girls' brain development accelerated due to social isolation during the COVID-19 pandemic, impacting their mental well-being more than boys.

Brain scans show teen girls aged 4 years faster than boys during COVID lockdowns. We asked the researcher what that means long-term.

Teen girls' brains aged faster during the pandemic, increasing the risk of mental health issues.
Isolation and social interaction are crucial factors in adolescent brain development.

Teen Girls' Brains Aged Rapidly During Pandemic, Study Finds

Girls' brain development accelerated due to social isolation during the COVID-19 pandemic, impacting their mental well-being more than boys.

Brain scans show teen girls aged 4 years faster than boys during COVID lockdowns. We asked the researcher what that means long-term.

Teen girls' brains aged faster during the pandemic, increasing the risk of mental health issues.
Isolation and social interaction are crucial factors in adolescent brain development.
morecortical-thinning

Covid lockdowns prematurely aged girls' brains more than boys', study finds

Adolescent girls showed more rapid brain aging than boys due to Covid lockdowns, with potential implications for mental health and learning capability.

Light pollution is shrinking the brains of city-dwelling spiders, study says

Light pollution negatively impacts brain development in city-dwelling spiders, affecting their foraging and navigation abilities.

Scientists say they may have discovered a shocking cause of autism

BPA chemical linked to increased autism risk in boys.

Dear daughter: Why you're not getting a phone until high school

Limit phone usage for kids, encourage boredom and reading for brain development.

Does your brain reflect your sex? - Harvard Gazette

Precision medicine is just one field where the answer matters

These brain cells help days-old mice to bond with mum

Scientists identified neurons in baby mice brains responsible for mother-baby bond formation.

Opinion: Does social media rewire kids' brains? Here's what science really says

The root causes of mental health issues in young people are complex and nuanced, with social media impact still largely inconclusive.

Scientists restore brain cells impaired by a rare genetic disorder

Scientists have successfully restored brain cells impaired by Timothy syndrome using antisense oligonucleotides, offering hope for treating other genetic conditions.

Study links fermented foods with brain growth - Harvard Gazette

Fermentation, not fire, may have been the key driver behind the evolutionary increase in human cranial capacity.
Brain tissue is energetically expensive, and changes in diet, possibly due to fermentation, could have fueled the expansion of our ancestors' brains.

Taking Prozac during pregnancy can affect fetal brain development: study

Antidepressants like Prozac during pregnancy may impact child's brain development and mental health later in life.
Serotonin levels in the prefrontal cortex play a crucial role in brain development, affecting cognition.

Why scientists say you really should maintain a routine with kids

Regular family routines are linked to children getting more sleep each night.
Shorter sleep duration is associated with changes in the child's brain structure.

For children living with war, every day threats lead to trauma

Children living in war zones experience trauma that can have long-lasting effects on their brain development and functioning.
Living in constant fear and exposure to violence can keep the brain in a state of fight, flight, or freeze response.

Disruptive children could have smaller brains

Disruptive children may have smaller brain areas regulating behavior and emotions, affecting conduct disorder development.

These 3D model brains with cells from several people are first of their kind

Chimeric brain 'organoids' can reveal individual variations in brain development and drug response.
[ Load more ]